ID: 974670536

View in Genome Browser
Species Human (GRCh38)
Location 4:65024462-65024484
Sequence TTAATGCCTTTGCTGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974670536_974670543 25 Left 974670536 4:65024462-65024484 CCCACCAACAGCAAAGGCATTAA No data
Right 974670543 4:65024510-65024532 TGACCCAGACACCACCCACTAGG No data
974670536_974670539 -9 Left 974670536 4:65024462-65024484 CCCACCAACAGCAAAGGCATTAA No data
Right 974670539 4:65024476-65024498 AGGCATTAATTTATTCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974670536 Original CRISPR TTAATGCCTTTGCTGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr