ID: 974672196

View in Genome Browser
Species Human (GRCh38)
Location 4:65046725-65046747
Sequence AGATGGGCAGGCAAGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974672196_974672201 -3 Left 974672196 4:65046725-65046747 CCAAATGCCTTGCCTGCCCATCT No data
Right 974672201 4:65046745-65046767 TCTGTGCCATATTAGACATCTGG No data
974672196_974672203 7 Left 974672196 4:65046725-65046747 CCAAATGCCTTGCCTGCCCATCT No data
Right 974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974672196 Original CRISPR AGATGGGCAGGCAAGGCATT TGG (reversed) Intergenic
No off target data available for this crispr