ID: 974672197

View in Genome Browser
Species Human (GRCh38)
Location 4:65046732-65046754
Sequence ATGGCACAGATGGGCAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974672197_974672203 0 Left 974672197 4:65046732-65046754 CCTTGCCTGCCCATCTGTGCCAT No data
Right 974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG No data
974672197_974672201 -10 Left 974672197 4:65046732-65046754 CCTTGCCTGCCCATCTGTGCCAT No data
Right 974672201 4:65046745-65046767 TCTGTGCCATATTAGACATCTGG No data
974672197_974672206 26 Left 974672197 4:65046732-65046754 CCTTGCCTGCCCATCTGTGCCAT No data
Right 974672206 4:65046781-65046803 TTGTATGCACATCAACGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974672197 Original CRISPR ATGGCACAGATGGGCAGGCA AGG (reversed) Intergenic
No off target data available for this crispr