ID: 974672199

View in Genome Browser
Species Human (GRCh38)
Location 4:65046741-65046763
Sequence ATGTCTAATATGGCACAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974672199_974672206 17 Left 974672199 4:65046741-65046763 CCCATCTGTGCCATATTAGACAT No data
Right 974672206 4:65046781-65046803 TTGTATGCACATCAACGTGATGG No data
974672199_974672203 -9 Left 974672199 4:65046741-65046763 CCCATCTGTGCCATATTAGACAT No data
Right 974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974672199 Original CRISPR ATGTCTAATATGGCACAGAT GGG (reversed) Intergenic
No off target data available for this crispr