ID: 974672200

View in Genome Browser
Species Human (GRCh38)
Location 4:65046742-65046764
Sequence GATGTCTAATATGGCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974672200_974672206 16 Left 974672200 4:65046742-65046764 CCATCTGTGCCATATTAGACATC No data
Right 974672206 4:65046781-65046803 TTGTATGCACATCAACGTGATGG No data
974672200_974672203 -10 Left 974672200 4:65046742-65046764 CCATCTGTGCCATATTAGACATC No data
Right 974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974672200 Original CRISPR GATGTCTAATATGGCACAGA TGG (reversed) Intergenic
No off target data available for this crispr