ID: 974672203

View in Genome Browser
Species Human (GRCh38)
Location 4:65046755-65046777
Sequence ATTAGACATCTGGACAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974672196_974672203 7 Left 974672196 4:65046725-65046747 CCAAATGCCTTGCCTGCCCATCT No data
Right 974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG No data
974672195_974672203 13 Left 974672195 4:65046719-65046741 CCACAGCCAAATGCCTTGCCTGC No data
Right 974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG No data
974672199_974672203 -9 Left 974672199 4:65046741-65046763 CCCATCTGTGCCATATTAGACAT No data
Right 974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG No data
974672197_974672203 0 Left 974672197 4:65046732-65046754 CCTTGCCTGCCCATCTGTGCCAT No data
Right 974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG No data
974672200_974672203 -10 Left 974672200 4:65046742-65046764 CCATCTGTGCCATATTAGACATC No data
Right 974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG No data
974672198_974672203 -5 Left 974672198 4:65046737-65046759 CCTGCCCATCTGTGCCATATTAG No data
Right 974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974672203 Original CRISPR ATTAGACATCTGGACAAACT TGG Intergenic
No off target data available for this crispr