ID: 974688523

View in Genome Browser
Species Human (GRCh38)
Location 4:65265560-65265582
Sequence AGTAATCTGCTGAGGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974688523_974688527 4 Left 974688523 4:65265560-65265582 CCCACCATCCTCAGCAGATTACT No data
Right 974688527 4:65265587-65265609 TCCTTTTGAAAAACAGTTTTTGG No data
974688523_974688529 15 Left 974688523 4:65265560-65265582 CCCACCATCCTCAGCAGATTACT No data
Right 974688529 4:65265598-65265620 AACAGTTTTTGGCCTGCTACTGG No data
974688523_974688530 16 Left 974688523 4:65265560-65265582 CCCACCATCCTCAGCAGATTACT No data
Right 974688530 4:65265599-65265621 ACAGTTTTTGGCCTGCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974688523 Original CRISPR AGTAATCTGCTGAGGATGGT GGG (reversed) Intergenic
No off target data available for this crispr