ID: 974696520

View in Genome Browser
Species Human (GRCh38)
Location 4:65382099-65382121
Sequence CTGTGCGGCCATTCATCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974696516_974696520 4 Left 974696516 4:65382072-65382094 CCCAAATTGTACAAATCTAAGTG 0: 1
1: 0
2: 0
3: 20
4: 252
Right 974696520 4:65382099-65382121 CTGTGCGGCCATTCATCTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 38
974696514_974696520 6 Left 974696514 4:65382070-65382092 CCCCCAAATTGTACAAATCTAAG 0: 1
1: 0
2: 1
3: 17
4: 244
Right 974696520 4:65382099-65382121 CTGTGCGGCCATTCATCTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 38
974696515_974696520 5 Left 974696515 4:65382071-65382093 CCCCAAATTGTACAAATCTAAGT 0: 1
1: 0
2: 1
3: 19
4: 291
Right 974696520 4:65382099-65382121 CTGTGCGGCCATTCATCTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 38
974696517_974696520 3 Left 974696517 4:65382073-65382095 CCAAATTGTACAAATCTAAGTGT 0: 1
1: 0
2: 3
3: 19
4: 191
Right 974696520 4:65382099-65382121 CTGTGCGGCCATTCATCTTAAGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974696520 Original CRISPR CTGTGCGGCCATTCATCTTA AGG Intronic
900786016 1:4651120-4651142 CTCTGAGGCCATTTATCTAATGG - Intergenic
900954701 1:5879332-5879354 CTGTGAGGCCTTACATTTTAAGG + Intronic
906341680 1:44986460-44986482 CGGTGGGGCCACTCATCTGAGGG - Intronic
921444070 1:215223731-215223753 CTGTTCGGACACTCATCTTTTGG + Intronic
922957690 1:229617911-229617933 CTGTATGGCCATGGATCTTAAGG + Intronic
923766460 1:236896609-236896631 CTGTGCGGCCACTGATACTAGGG - Intronic
923907799 1:238404554-238404576 CTCTGCTGGCATTCATCTCAGGG + Intergenic
1079514191 11:21247778-21247800 CTGTGCTGCCAATCATATAACGG - Intronic
1080232131 11:30028489-30028511 CTTTGCGGCTTTTCTTCTTATGG + Intergenic
1093938855 12:25030874-25030896 GTCTGCAGCCATTCATTTTAGGG + Intronic
1094556772 12:31508704-31508726 GTGTGTGGCCTTTCATCTAAAGG + Intronic
1098108634 12:67097875-67097897 CTGTGCTGCCAGTCATATAAAGG + Intergenic
1108068911 13:46607277-46607299 CTTTGCTGCCATTCATTTTGTGG + Intronic
1112372960 13:98811013-98811035 CTGAGCTGGCATTCATCTCATGG + Intronic
1122570655 14:102697394-102697416 CTGTGCTGCCTTTTATCTTGTGG + Intronic
1128726357 15:69991290-69991312 CTGTTCGGCAATTCATTTAAGGG + Intergenic
1140470435 16:75210945-75210967 CCGTGCGGCCACTCATCTCACGG + Intergenic
1140829044 16:78734449-78734471 CTGTGCGTCCTTAAATCTTACGG + Intronic
1144779128 17:17799170-17799192 CTGTGCCGCCATGCACCTTTGGG + Intronic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
928997039 2:37303526-37303548 CTGTGGGGCCCTTCAACCTAAGG - Intronic
932106257 2:68945367-68945389 CTGTGCAGACATTCATGTTTAGG - Exonic
943404093 2:187457597-187457619 CTGTGCTGCCAGTCATATAAAGG - Intergenic
946309083 2:218872872-218872894 CTGTCCGGACATTCCTCTTCAGG - Intronic
949126256 3:448298-448320 CTGGGCAGCCATTCATATGAAGG - Intergenic
951475090 3:23096544-23096566 CTGTGCTGCCAGTCATATGAAGG + Intergenic
974595511 4:64010378-64010400 TTGTCCTGCCATTCATCCTATGG + Intergenic
974696520 4:65382099-65382121 CTGTGCGGCCATTCATCTTAAGG + Intronic
983894486 4:173067768-173067790 CTGTGCTGCGATCCATCTTCAGG + Intergenic
984652288 4:182283446-182283468 CTGTGTGAACATTCATCTTTTGG + Intronic
986569933 5:9154385-9154407 CTCTGAGGCCATTCAACTTCAGG + Intronic
988124331 5:27009538-27009560 CTGTGGGTCCATTCACCTTCTGG + Intronic
990102729 5:52213340-52213362 CTGTGCTGCCAGTCATATAAAGG + Intergenic
992943145 5:81782940-81782962 CTGTGCTGCCAGTCATATAAAGG - Intergenic
995064341 5:107843378-107843400 CTGTGCTGCCATTGATGTTGTGG - Intergenic
999684282 5:154088524-154088546 CTGTCCTGCAATTCATCTTACGG - Intronic
1018039726 6:159911226-159911248 CTGTGTGTCCAATCATCTAATGG + Exonic
1022056295 7:26738528-26738550 CTGTGTGGCCTTTCACCTTAGGG - Intronic
1042811321 8:72828388-72828410 CTATGAGGCCATTCATCATATGG + Intronic
1055575419 9:77656329-77656351 CTGTGAGGCCATACATGATAGGG + Intergenic
1056241175 9:84647942-84647964 CTGTGCAGCAATTCATCTACAGG + Intergenic
1187439721 X:19307272-19307294 CTGTGGGGGCATCCATCTTGTGG + Intergenic
1192143797 X:68666940-68666962 CTGTGGGTGCATTCATCTAAGGG - Intronic