ID: 974696853

View in Genome Browser
Species Human (GRCh38)
Location 4:65387429-65387451
Sequence ATCTTTCTGCCTAAGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974696853 Original CRISPR ATCTTTCTGCCTAAGCCTTG GGG (reversed) Intronic
900864280 1:5256052-5256074 ATCTTTCTGCTTCTGCCCTGGGG - Intergenic
901122477 1:6906889-6906911 ACCTTTCTGCCTTAGCCATGTGG + Intronic
903866660 1:26403826-26403848 CTCTTCCTGCCTATGCCTTGTGG + Intergenic
904178319 1:28647392-28647414 ATCCTTCTGCCTCAGCCTTTGGG + Intergenic
905135221 1:35794192-35794214 ATCCTTCTGCCTCAGCTTCGTGG + Intergenic
905217529 1:36419917-36419939 ATCCTTCTGCCTCAACCTCGTGG + Intronic
905809309 1:40900149-40900171 ATCCTTCTGCCTCAGCCTACTGG - Intergenic
907901378 1:58744471-58744493 ATATTTCTGCCTATGGCTAGGGG - Intergenic
908454474 1:64289548-64289570 TTCATTCTGCCTCAGCCATGTGG - Intergenic
909344973 1:74574095-74574117 ATCTTCCTGCCTCAGCCTCTTGG + Intronic
910884552 1:91951121-91951143 ATTCTTCTGCCTAAGCCTACTGG + Intronic
910983326 1:92980197-92980219 ATCTTCCTGCCTTAGCCCTTCGG + Intergenic
911119204 1:94278210-94278232 ATCTCTCTGCCTCAGCCTTCTGG - Intergenic
911521067 1:98931556-98931578 TCCTTTCTCCCTCAGCCTTGGGG + Intronic
913199026 1:116481505-116481527 ATCTTACTGCCTATGCACTGTGG - Intergenic
913530872 1:119733445-119733467 ATCCTCCTGCCTCAGCCTTCTGG + Intronic
913721123 1:121596643-121596665 ATCCTTCTGCCTCAGCCTCCTGG + Intergenic
917100439 1:171439868-171439890 ATTTTTCTGCCTTAGCCTACTGG + Intergenic
917287243 1:173434034-173434056 ATGTTTCTCCCTTAGCTTTGGGG - Intergenic
918442669 1:184583537-184583559 AGCTTTCAACCTAAGCCTTGGGG - Intronic
918606341 1:186431510-186431532 ACCTTTCTGCTTAAGTTTTGTGG - Intergenic
918844722 1:189594793-189594815 ATTTTTCCTCCTAAGCCTTTGGG - Intergenic
918935152 1:190912294-190912316 ATTTTTCTTCCTAGGCCTCGAGG + Intergenic
919644768 1:200084285-200084307 CTCTTTCTGTTTAAGCCTTCAGG + Intronic
920196790 1:204233279-204233301 ATCTTCCAGCCTAAGCCTCCTGG + Intronic
920852563 1:209638377-209638399 ATCTTTCTGCCTCATATTTGGGG - Intronic
923013881 1:230110668-230110690 TTTTCTATGCCTAAGCCTTGAGG + Intronic
924810077 1:247393195-247393217 ATCTTCCTGCCTCAGCCTCTCGG + Intergenic
1062940590 10:1417878-1417900 CTCTTCCTGCCTAAACTTTGAGG - Intronic
1064247859 10:13683488-13683510 ATCTTCCTGCCTCAGCCTTTTGG - Intronic
1065010860 10:21419401-21419423 ATCCTTCTGCCTTAGCCTCCTGG - Intergenic
1065409575 10:25409403-25409425 ATATTTCTGCCTCAACCTTCAGG + Intronic
1065639207 10:27764735-27764757 ATCCTCCTGCCTCAGCCTTCTGG + Intergenic
1065724722 10:28658488-28658510 ATTTTCCTGCCTCAGCCTTCTGG + Intergenic
1065836148 10:29660200-29660222 ATCTTTCTTCCTCAGCCTGTTGG - Intronic
1066448901 10:35510319-35510341 ATCTTCCTGCCTCAGCCTCCTGG + Intronic
1068553377 10:58430965-58430987 ATCCTTCTGCCTCAGACTTCTGG + Intergenic
1068762202 10:60724819-60724841 ATCTCTTTGGTTAAGCCTTGTGG + Intronic
1069225683 10:65941528-65941550 ATTTTTCTTCCTTAGCCTGGGGG - Intronic
1070008435 10:72449038-72449060 ATCTTCCTGCCTCAGCCTCCAGG + Intronic
1070071347 10:73093011-73093033 ATCCTTCTGCCTCAGCCTCCGGG - Intronic
1073754842 10:106570674-106570696 ATCTTTTTTCCTAAGCTTTATGG + Intergenic
1074082763 10:110180826-110180848 ATCTTCCCGCCTCAGCCTTTTGG - Intergenic
1074364799 10:112849342-112849364 CTCTCTCTGCCTGAGCCCTGAGG + Intergenic
1074472111 10:113736784-113736806 ATCTTTCTTCAAGAGCCTTGTGG + Intergenic
1075883789 10:125879128-125879150 ATCCTTCTGCCTCAGCCTCTTGG + Intronic
1078113473 11:8420891-8420913 ATCCTTCTGCCTCAGCCTCCTGG - Intronic
1078119385 11:8490717-8490739 ATATTTCTGCCTGATCCTTCTGG - Intronic
1078130502 11:8610325-8610347 ATCTTCCTGCCTCAGCCTCCTGG - Intergenic
1079366517 11:19814704-19814726 ATCCTCCTGCCTCAGCCTTCTGG + Intronic
1081929293 11:46857604-46857626 CTTTTTCTGACCAAGCCTTGTGG - Exonic
1082780979 11:57287248-57287270 ATCCCTCTGCCTAGGCCCTGTGG - Intergenic
1085239140 11:75037146-75037168 ATTCTCCTGCCTCAGCCTTGAGG - Intergenic
1087086771 11:94227347-94227369 ATCTCTCTGCTTCTGCCTTGAGG + Intergenic
1088530412 11:110802044-110802066 ACCTTTCTTCCAAAGCCTTTCGG + Intergenic
1091143933 11:133260644-133260666 TTCCTTCTGCCTGGGCCTTGAGG - Intronic
1091518678 12:1213177-1213199 CTCTTTCTGCCTAAATCTTTTGG + Intronic
1091909669 12:4219415-4219437 ATCCTTCTGCCTCAGCCTCCTGG + Intergenic
1093167689 12:15823987-15824009 ATCCTCCTGCCTCAGCCTTCCGG + Intronic
1093373192 12:18388970-18388992 ACATTCCTGGCTAAGCCTTGAGG - Intronic
1093436675 12:19142260-19142282 ATCCTTCTGCCTCAGCCTCCTGG - Intronic
1094563032 12:31573846-31573868 ATCTTCCTGCCTCAGCCTCCTGG - Intronic
1095252293 12:39992746-39992768 ATCTTTCTGTCTAATCTTGGTGG - Intronic
1095395099 12:41753819-41753841 ATCTGTCTGCCTCAGCCTCTCGG + Intergenic
1096837583 12:54360892-54360914 ACTTTTCTTCCTAAGCTTTGGGG + Intergenic
1097035466 12:56120897-56120919 TACTTTCTGCCTCAGCCGTGGGG - Exonic
1097517862 12:60628126-60628148 ATCTCCCTGCCTTAGCCTTGTGG + Intergenic
1098527699 12:71505183-71505205 ATTTTTCTACTGAAGCCTTGAGG - Intronic
1102394902 12:112577010-112577032 ATCCTTCTGCCTCAGCCTCCTGG + Intronic
1102446840 12:113009556-113009578 ATCTTTCTGCCTTTGGCTTTTGG + Intronic
1102849061 12:116221266-116221288 ATCTTCCCACCTCAGCCTTGTGG - Intronic
1102967421 12:117138956-117138978 ATCTTCCTGCCTCAGCCTCCTGG + Intergenic
1103229234 12:119314189-119314211 ATCTTTCTGTCTCACCCGTGGGG + Intergenic
1103839157 12:123848716-123848738 GTCTTTCTTCCTAGGCCGTGGGG + Exonic
1105323580 13:19349856-19349878 TTCTTTCTGCCTCTGCCGTGTGG + Intergenic
1108478628 13:50844352-50844374 ACCTTGCTGCCTAAGTCTTTTGG - Intergenic
1109237894 13:59846970-59846992 ATCTTCCTGCCTCAGCCTCCTGG - Intronic
1112172936 13:96993137-96993159 ATCTTTCTCCCCAACCCTTCTGG + Intronic
1112565616 13:100549230-100549252 ATCTTCCTGCCTCAGCCTCCTGG - Intronic
1112820773 13:103332407-103332429 ATCTTTTTGCCTTTCCCTTGAGG + Intergenic
1113387803 13:109866612-109866634 ATTCTTCTGCCTCAGCCTTCTGG - Intergenic
1113747135 13:112753014-112753036 ATCTTTCACTCTAAGTCTTGGGG + Intronic
1114359610 14:21957258-21957280 ATCTTCCTGCCTCAGCCTGCTGG - Intergenic
1114517571 14:23309595-23309617 ATGTTTCTCTCTAAGCCTTGAGG - Exonic
1115006558 14:28492367-28492389 ATTTTTCTGCCTGGGCCCTGAGG + Intergenic
1115986626 14:39109140-39109162 ATCTTTCCACCTAAGCCTCCTGG + Intronic
1116798873 14:49421327-49421349 ATCTTTCTACCAAAGACCTGTGG - Intergenic
1117670477 14:58100926-58100948 TTCTTTCTGCCTTAGCATGGAGG - Intronic
1117749186 14:58902882-58902904 TTTTTTCTGCCTAGGCCTTAGGG - Intergenic
1120562920 14:86018730-86018752 ATCTTTCTGCCTCTGTCTGGAGG - Intergenic
1121249063 14:92486135-92486157 ATCATTCTTCCAAAGCCTTGGGG - Intronic
1122519110 14:102330639-102330661 ATTCTTCTGCCTCAGCCTTCAGG + Intronic
1123692299 15:22848467-22848489 ATCCTTCTGCCTCAGCCTCCTGG + Intronic
1124222125 15:27859840-27859862 ATCTTTTTTCCCAAGCCCTGGGG - Intronic
1125840278 15:42794020-42794042 ATCCTTCTGCCTCAGCATTTTGG + Intronic
1127201556 15:56659093-56659115 ATCTTTCTGCCTCAGTCTCCTGG + Intronic
1128172404 15:65524362-65524384 ATTCTTCTGCCTCAGCCTTCAGG - Intergenic
1128628892 15:69242948-69242970 ATCCTTCTGCCTTAGCCTCCTGG - Intronic
1128664232 15:69526657-69526679 TTTTTACTGCCTCAGCCTTGGGG + Intergenic
1128881777 15:71250442-71250464 ATCCTTCTGCCTCAGCCTACAGG + Intronic
1129442030 15:75588571-75588593 ATCTTCCTGCCTTAGCCTCCAGG - Intergenic
1129603767 15:77014823-77014845 ATATTCCTGCCTCTGCCTTGAGG - Intronic
1130675828 15:85951168-85951190 CCCTTTCTTCCTAACCCTTGAGG + Intergenic
1132763059 16:1520335-1520357 GTCTCTCTGCCTAGGCCATGAGG - Exonic
1134683605 16:16143641-16143663 ATCTTCCTGCCTCAGCCTCCTGG + Intergenic
1135465700 16:22683094-22683116 TTCTTTCTTCCTAACCCCTGTGG + Intergenic
1135584254 16:23656118-23656140 ATCCTTCTGCCTCAGCCTCCAGG - Intronic
1137624412 16:49898720-49898742 ATCATTCTGCCTCAGCCTCCTGG - Intergenic
1138098093 16:54229361-54229383 AACTTTCTGGCCAAGCATTGTGG - Intergenic
1138113652 16:54343429-54343451 ATCTTCCTGCCTCAGCCTCTCGG + Intergenic
1138557224 16:57778790-57778812 ATCTTTGTGCCTCAGCCTCCTGG - Intronic
1139565595 16:67773683-67773705 ACCTTTTTCCCTAAGCCATGTGG - Intronic
1143238479 17:5423409-5423431 ATCCTCCTGCCTAAGCCTTCTGG - Intronic
1144478505 17:15609965-15609987 ATTTTTCTGCCTCAGCCTCCCGG + Intronic
1144967220 17:19085021-19085043 ATCCTCCTGCCTCAGCCTTCTGG - Intergenic
1144980700 17:19167046-19167068 ATCCTCCTGCCTCAGCCTTCTGG + Intergenic
1144987522 17:19211187-19211209 ATCCTCCTGCCTCAGCCTTCTGG - Intergenic
1145852900 17:28120507-28120529 GTCTTCCTGCCTCAGCCTTCTGG - Intronic
1145990375 17:29075729-29075751 TTCTTTCTCCCAAAGCCTTGGGG + Exonic
1147699128 17:42380804-42380826 ATCCTCCTGCCTCAGCCTTCGGG - Intronic
1148764915 17:50032470-50032492 ATCCTCCTGCCTCAGCCTTCTGG + Intergenic
1148881977 17:50735610-50735632 ATCCTTCTGCCTCAGCCTCCTGG + Intronic
1149156380 17:53634747-53634769 ATCATTCTGCATAAATCTTGTGG + Intergenic
1149435115 17:56627250-56627272 ATCTTTTTGGCAAAGCTTTGAGG - Intergenic
1150158968 17:62877937-62877959 ATCTTCCTGCCTTAGCCTCCTGG - Intergenic
1150804065 17:68305065-68305087 ATCCTTCTGCCTCAGCCTCCCGG - Intronic
1151573272 17:74937872-74937894 TCCTCTCTGCCTAAGCCTTCTGG - Intronic
1152024665 17:77801158-77801180 ATCTTTCTTCCTGCGCCGTGGGG - Intergenic
1153197963 18:2621991-2622013 ATCCTCCTGCCTCAGCCTTTTGG + Intergenic
1153540445 18:6148530-6148552 ATCCTTCTGCCTCAGCCTGCTGG + Intronic
1154489535 18:14909091-14909113 TTCTTTCTGCCAAAGCCATCAGG + Intergenic
1155764056 18:29605523-29605545 TTTTTTCCTCCTAAGCCTTGAGG - Intergenic
1155837738 18:30608101-30608123 ATCCTCCTGCATAAGCCATGTGG - Intergenic
1158497715 18:57971331-57971353 TTCTTTCTGCCTATTCCCTGAGG + Intergenic
1158668358 18:59452867-59452889 ATCTTTCTGCAAATGCATTGTGG - Intronic
1159077812 18:63701253-63701275 TTTTTTCTGTCTAAGCATTGGGG - Intronic
1159230417 18:65600529-65600551 ATTCTTCTGCCTCAGCCTTCCGG - Intergenic
1162045313 19:7996017-7996039 ATCCTCCTGCCTCAGCCTTCTGG + Intronic
1162359144 19:10207070-10207092 CTCTTTCTGCCTAAGACATGTGG + Intronic
1162620319 19:11837959-11837981 ATCCTTCTGCCTCAGCCTCCTGG - Intergenic
1163080751 19:14940389-14940411 CCCTTTCTGCCTAAGGCATGGGG - Intergenic
1164944531 19:32282360-32282382 ATCTTTCTTCCCAAGACGTGTGG + Intergenic
925698191 2:6605427-6605449 ATCTTTCTGCCGCAGGATTGAGG + Intergenic
926071761 2:9900427-9900449 ATCCTCCTGCCTCAGCCTTCTGG - Intronic
926552248 2:14314931-14314953 ATCTTCCTTCCTAATCTTTGAGG + Intergenic
926711499 2:15885646-15885668 ATCTTCCTGCCTCAGCCTCCAGG - Intergenic
927530421 2:23792854-23792876 ATTCTTCTGCCTAAGCCTCCTGG - Intronic
933262919 2:80150363-80150385 ATCTCTCTTCTTCAGCCTTGAGG + Intronic
933730291 2:85451119-85451141 ATCCTTCTGCCTCAGCCTCCTGG - Intergenic
935311566 2:101788756-101788778 CACTTTCTGACTAAGTCTTGAGG + Intronic
935709332 2:105883515-105883537 TTCTTTCTGCCTAAGATTTGGGG + Intronic
936486022 2:112926460-112926482 ATCTGTCTGCCTCAGCCTCCTGG + Intergenic
937691275 2:124758089-124758111 ATGGTTCTGCCTAGGCTTTGGGG - Intronic
937694103 2:124788705-124788727 ATTTTTCTGCCTCAGCCTCCTGG + Intronic
937994533 2:127682881-127682903 ATCCTCCTGCCTCAGCCTTCTGG + Intergenic
938556325 2:132427802-132427824 ATCCTTCTGCCTTAGCCTCTTGG + Intronic
939750304 2:146036147-146036169 ATCTTTCTGACTATTCCTGGTGG - Intergenic
940084962 2:149848853-149848875 TCCTTTTTGCCTATGCCTTGGGG + Intergenic
943483926 2:188456310-188456332 ATTTTTCTTCCTAGGCCTTCCGG - Intronic
944279577 2:197879801-197879823 ATCTTTCTGCCTAAGGTCTTTGG + Intronic
944660544 2:201918025-201918047 ATCTTCCTGCCTCAGCCTCCTGG + Intergenic
944799998 2:203229841-203229863 ATCTTCCTGCCTCAGCCTCCTGG - Intergenic
945055293 2:205863310-205863332 ATTTTTCTGACAAAGCCTTGTGG + Intergenic
945649923 2:212544383-212544405 ATCTTTCTGCATAATCTTTTTGG - Intergenic
947981826 2:234416965-234416987 ATCTTTCTGCCCATGCTGTGTGG - Intergenic
948640307 2:239371780-239371802 ATCTTTGTGCAAAAGCTTTGAGG - Intronic
1170443450 20:16401389-16401411 ATCTGTCTGCCTAATCCCAGGGG - Intronic
1170645116 20:18190952-18190974 ACCGCTCTGGCTAAGCCTTGGGG + Intergenic
1172087949 20:32403519-32403541 ATCCTCCTGCCTCAGCCTTCCGG + Intronic
1173828877 20:46065500-46065522 ATCCTGCTCCCTAAGACTTGTGG + Intronic
1173864242 20:46304106-46304128 ATCCTTCTTCCTTTGCCTTGAGG - Intronic
1174314406 20:49686790-49686812 ATCCTTCCACCTCAGCCTTGTGG - Intronic
1175032170 20:55965634-55965656 CTCTTTATGCCCAAGCATTGGGG - Intergenic
1175074668 20:56362541-56362563 ATTTTTCTTCCTAACCTTTGGGG - Intronic
1177149785 21:17444162-17444184 ATCCTCCTGCCTCAGCCTTCTGG + Exonic
1177342204 21:19818039-19818061 ATCTATCTGCCTAAACCCTCAGG - Intergenic
1177653915 21:23992394-23992416 ATCCTTCCACCTCAGCCTTGTGG + Intergenic
1179265288 21:39797621-39797643 ATCCTCCTGCCTCAGCCTTCCGG + Intronic
1179371574 21:40810657-40810679 ATCTTCCTGCCTTAGCCTCTTGG - Intronic
1181472197 22:23147434-23147456 ATCCTTCTGCCTCAGCCTCCCGG + Intronic
1184252869 22:43270878-43270900 AACTTTCAGCCTAACCCTTTGGG - Intronic
1184508524 22:44918471-44918493 ATCTTTCTGCCTGTGCCTCCTGG + Intronic
949209472 3:1480495-1480517 ATCTTTCTTGCTTTGCCTTGTGG - Intergenic
949335181 3:2967077-2967099 ATCATTCTCCCTGAGCATTGGGG + Intronic
951673620 3:25212509-25212531 ATCCTTCTGCCTCAGCCTCCCGG - Intronic
952366470 3:32679112-32679134 ATCTGCCTGCCTTAGCCTTAAGG + Intergenic
954015134 3:47682383-47682405 ATCTTTCTGCCCCAGCCTCCAGG + Intronic
955219339 3:57010889-57010911 ATCTTTCTTTCTAAGCTTAGTGG - Intronic
960059024 3:113299922-113299944 ATCCTTCTGCCTCAGCCTCCTGG - Intronic
964043758 3:152296857-152296879 ATCATTATGGCTAAGCCATGGGG + Intronic
964850507 3:161091160-161091182 ATCCTTCTGCCTCAGCCTCCCGG - Intronic
965014925 3:163145904-163145926 AGCTTTTTGCCTAAGTCTTTAGG + Intergenic
965865918 3:173203659-173203681 TTCTTTCTTCCTAAGCCTCTGGG + Intergenic
966838978 3:184073122-184073144 ATCCTCCTGCCTCAGCCTTCTGG + Intergenic
967103835 3:186239404-186239426 AGCTTTCTTCCTATGCCTTGCGG + Intronic
968444418 4:642550-642572 ATCTGCCTGCCTTAGCCTTCCGG - Intronic
968563842 4:1298986-1299008 ATCTTCCTGCCTCAGCCTCCCGG + Intronic
968829266 4:2924003-2924025 CTCTTTCTCCATAAACCTTGAGG + Intronic
969877507 4:10146694-10146716 ATCCTCCTGCCTCAGCCTTCTGG - Intergenic
970227658 4:13876552-13876574 ATCCTTCTGCCTCAGCCTCCCGG + Intergenic
971426885 4:26524952-26524974 ATCCTCCTGCCTCAGCCTTCTGG + Intergenic
973791359 4:54380938-54380960 ATCCTTCTGCCTTAGCCTCTTGG + Intergenic
973903791 4:55506287-55506309 ATCTTCCTGCCTCAGCCTCCTGG + Intronic
973952532 4:56031023-56031045 ATCCTTCTGCCTCAGCCTCCAGG - Intronic
974696853 4:65387429-65387451 ATCTTTCTGCCTAAGCCTTGGGG - Intronic
974817966 4:67030721-67030743 TCCTTTCTGCCTAATCTTTGAGG - Intergenic
976777588 4:88722994-88723016 CCCTTGCTGTCTAAGCCTTGTGG + Intergenic
977303295 4:95293407-95293429 ATCCTCCTGCCTCAGCCTTCTGG + Intronic
977783806 4:101009326-101009348 TTCTTTCTGCATAAGCCCCGTGG - Intergenic
978071487 4:104477526-104477548 ATCTTTCTGCTAAAAACTTGTGG - Intronic
980990301 4:139733789-139733811 ATCTTCCTGCCTCAGCCTCCTGG + Intronic
981017809 4:139992630-139992652 ATCCTTCTGCCTCAGCCTCTCGG + Intronic
981270026 4:142835063-142835085 ACCTTTCTGCCTAAAACTTCAGG - Intronic
982128003 4:152200852-152200874 ATCCTCCTGCCTCAGCCTAGAGG - Intergenic
983560759 4:169099197-169099219 ATCTTCCTACCTCAGCCTTCCGG + Intronic
984776700 4:183487315-183487337 ATCTTCCTGCCTCAGCCTCCTGG - Intergenic
985696228 5:1342164-1342186 ATCTGGCTGCTTCAGCCTTGTGG - Intronic
988708066 5:33744918-33744940 ATCCTTCTGCCTCAGCCTTCTGG + Intronic
990100073 5:52172622-52172644 ATCCTTCTGCCTCAGCCTCCAGG + Intergenic
990440275 5:55837690-55837712 TTCCTTCTGTCTAAGCCTTGGGG + Intergenic
991249069 5:64539541-64539563 AGCTTTCTGCCTCAGCCTCCTGG - Intronic
991675470 5:69086234-69086256 ATCTGCCTGCCTAAGCCTCCAGG + Intergenic
992617891 5:78562851-78562873 TTCATTCTGCCAAAGCCTTCAGG - Intronic
992781468 5:80131972-80131994 ATCTTTCTCCATATGCCTTCTGG - Intronic
999510845 5:152250201-152250223 TGCTTTCTGCCAAAGCCTTTAGG - Intergenic
1000892267 5:166814331-166814353 ATTTTTCTGCCTCAGCCTCCTGG + Intergenic
1001232483 5:170000760-170000782 CCATTTCTGCCTAGGCCTTGAGG + Intronic
1007456521 6:41981892-41981914 ATCCTCCTGCCTCAGCCTTTTGG - Intronic
1007707449 6:43799489-43799511 ATCTTCTGGCCTAGGCCTTGGGG - Intergenic
1008069069 6:47080819-47080841 ATCCTTCTGCCTCAGCCTCCAGG - Intergenic
1008581147 6:52908406-52908428 ATCTTCCTGCCTCAGCCTCCTGG - Intronic
1009904570 6:69854089-69854111 GTCTTTCTGCCTAAAACTTTAGG - Intergenic
1011493362 6:87915298-87915320 ACCTTTCTCCCTCAGCCTTGAGG + Intergenic
1012659005 6:101862533-101862555 GTCCTTCTGCCTCAGCCTTGTGG + Intronic
1013951848 6:115792408-115792430 ATCTTTCTACCTAGGCCTCAGGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015508279 6:134011514-134011536 ATCTTCCTGCCTCAGCCTCCTGG - Intronic
1017085126 6:150706505-150706527 ATCCTCCTGCCTAAGCCTTCTGG - Intronic
1017592065 6:155988827-155988849 TACTTTCTCCATAAGCCTTGTGG + Intergenic
1019910552 7:4097971-4097993 ATGTCTCTGCCTAAGCGTTTAGG + Intronic
1020063899 7:5172813-5172835 ATCCTTCTGCCTCAGCCTCCCGG - Intergenic
1021876018 7:25050146-25050168 ATCTTGCCGTCTAAGCCTTTTGG + Intergenic
1022206582 7:28170179-28170201 ATCCTCCTGCCTCAGCCTTCTGG - Intronic
1022667397 7:32424576-32424598 ATCTGTCTGCCTTAGCCTCCAGG - Intergenic
1023039186 7:36157303-36157325 TTCTTTCTGACCAAGCGTTGAGG + Intronic
1023415985 7:39932871-39932893 ATTTTCCTGCCTCAGCCTTCCGG - Intergenic
1023498813 7:40826862-40826884 AGCTTTTTGCCTATCCCTTGAGG + Intronic
1023953751 7:44869094-44869116 TTATTTCTGCCTAAGATTTGTGG + Intergenic
1024296819 7:47850523-47850545 ATTCTCCTGCCTCAGCCTTGTGG - Intronic
1026043135 7:66885774-66885796 ATCCTTCTGCCTCAGCCTCCAGG + Intergenic
1026346038 7:69474973-69474995 ATCCTACTGCCTCAGCCTTCCGG - Intergenic
1026664451 7:72330359-72330381 ATTCTTCTGCCTCAGCCTTCCGG - Intronic
1026870385 7:73847550-73847572 ATCCTTCTGCCTCAGCCTCCTGG + Intergenic
1027007735 7:74709777-74709799 ATCTTTGTGCCTCAGCCTCTCGG + Intronic
1027224708 7:76236589-76236611 CTGTCTCTGCCTAAGCCTGGGGG - Intronic
1028447546 7:90942243-90942265 ATATTCCTTCCCAAGCCTTGGGG - Intronic
1029231406 7:99072262-99072284 ATCCTTCTGCCTCAGCCTCCCGG + Intronic
1030014719 7:105207241-105207263 ATCCTCCTGCCTCAGCCTGGTGG + Intronic
1033213721 7:139479432-139479454 ATCCTCCTGCCTCAGCCTTTTGG - Intronic
1035084733 7:156248297-156248319 ATCTTTCTTCCAAAACCTTCTGG - Intergenic
1036386449 8:8285789-8285811 ATCCTTCTGCCTTAGCCTGCTGG - Intergenic
1038157612 8:25005220-25005242 ATCTTTCTGTCTCAGCCTCTTGG - Intergenic
1038563634 8:28601446-28601468 ATCTTTCTTCCACAGCCTTGAGG + Intronic
1038636001 8:29287828-29287850 ATCCTTCTGCCTCAGCCTCCAGG + Intergenic
1038753341 8:30317053-30317075 ATCCTCCTGCCTAAGCCTCTTGG + Intergenic
1039525644 8:38213837-38213859 ATCCTTCTGCCTCAGCCTCCTGG + Intergenic
1040445734 8:47491741-47491763 ATCTTCCTGCCTCAGCCTCTTGG - Intronic
1041922090 8:63193512-63193534 ATCCTTCTGCCTCAGCCTCCTGG - Intronic
1042310631 8:67375776-67375798 ATCCTTCTGCCTCAGCCTCCTGG + Intergenic
1043577697 8:81676885-81676907 ATCCTTCTGCCTCAGCCTACCGG - Intronic
1043734468 8:83726247-83726269 AAATTTCTGCCTAAGCTTAGAGG - Intergenic
1045661130 8:104438960-104438982 ATCTTCCTGCCTCAGCCTCCAGG - Intronic
1047327603 8:123854656-123854678 CTCATTTTGTCTAAGCCTTGGGG + Intronic
1051198262 9:14587476-14587498 GTCTTTCTCCCTTAGCTTTGAGG - Intergenic
1052924924 9:34007387-34007409 ATCCTTCTGCCTCAGCCTCTCGG - Intronic
1052954894 9:34246171-34246193 ATCCTCCTGCCTCAGCCTTCTGG + Intronic
1053111771 9:35467145-35467167 ATTCTCCTGCCTCAGCCTTGAGG + Intergenic
1056518813 9:87380904-87380926 ATTCTCCTGCCTCAGCCTTGTGG - Intergenic
1057005715 9:91556782-91556804 ATCTTCCTGCCTCAGCCTCGTGG + Intergenic
1057357459 9:94343729-94343751 ATCCTTCTGCCTCAGCCTCTTGG + Intergenic
1057361855 9:94380572-94380594 ATCTTCCTGCCTCAGCCTCCTGG + Intronic
1057650292 9:96913897-96913919 ATCCTTCTGCCTCAGCCTCTTGG - Intronic
1057661502 9:97007594-97007616 ATCTTCCTGCCTCAGCCTCCTGG - Intronic
1057779654 9:98039255-98039277 ATCTTCCTGCCTCAGCCTCTTGG + Intergenic
1058412080 9:104744996-104745018 ACCCTTTTGCTTAAGCCTTGTGG + Intergenic
1058977258 9:110136606-110136628 TTCTTTCTGCCTCTGCCATGGGG - Exonic
1059652823 9:116331759-116331781 TTCTTTCTGGCTAAGGATTGTGG + Intronic
1061379695 9:130246975-130246997 ATCTGTCTGCCTCAGCCTCCCGG - Intergenic
1061692612 9:132345910-132345932 ATACTCCTGCCTGAGCCTTGTGG - Intronic
1187047413 X:15660698-15660720 ATCTTCCTGCCTTAGCCTCCTGG - Intronic
1189764764 X:44359406-44359428 ATCATTCTGCCTCAGCCTCTAGG - Intergenic
1190199355 X:48347028-48347050 CTCTTCTTGCCTCAGCCTTGGGG - Exonic
1190733264 X:53238484-53238506 ATCCTTCTGCCTCAGCCTCCTGG + Intronic
1191190585 X:57662475-57662497 TTCTTTCTGCTTCAGTCTTGGGG - Intergenic
1193480592 X:82022979-82023001 TTCTTTGTGCCTAAGACTTGGGG - Intergenic
1196295226 X:113989316-113989338 ATCTGTCTGCCTAAAACTTGTGG - Intergenic
1196899095 X:120365824-120365846 AGCTTTTTGCCTAAGCATAGGGG + Intronic
1197012397 X:121582015-121582037 GTCTATCTGCCTAGCCCTTGGGG + Intergenic
1197626190 X:128804657-128804679 ATTCTCCTGCCTCAGCCTTGCGG - Intergenic
1198760090 X:140023137-140023159 ATTCTTCTGCCTCAGCCTCGCGG - Intergenic
1201935834 Y:19410060-19410082 ATATTTCTGCCTAGGCATTCAGG - Intergenic