ID: 974697047

View in Genome Browser
Species Human (GRCh38)
Location 4:65389733-65389755
Sequence CATTGAGAACTATTGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974697044_974697047 -10 Left 974697044 4:65389720-65389742 CCAACATCAGAGGCATTGAGAAC 0: 1
1: 0
2: 0
3: 12
4: 116
Right 974697047 4:65389733-65389755 CATTGAGAACTATTGGAGGTAGG 0: 1
1: 0
2: 1
3: 25
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974697047 Original CRISPR CATTGAGAACTATTGGAGGT AGG Intronic
901661725 1:10802443-10802465 CATTGACAACCATAGGTGGTAGG - Intergenic
904985959 1:34549197-34549219 CACTGAGAACAAATGGAGGGAGG + Intergenic
906874458 1:49521895-49521917 CATTGGAAACTATTAGAGGGGGG + Intronic
907342689 1:53748094-53748116 CATTGAGAAGGCTTGGAGCTAGG - Intergenic
907796466 1:57722990-57723012 CATTGAAAGCTTTTGGAGATGGG - Intronic
912689850 1:111796612-111796634 CACTGGGAACTATTGGAGGGTGG + Intronic
916864321 1:168838846-168838868 CACTGAGGCCTATTGGAGGATGG + Intergenic
917300397 1:173568287-173568309 CACTGAGATCTACTTGAGGTGGG - Intronic
918268731 1:182873941-182873963 CATTGGGAACTCTTTCAGGTTGG - Intronic
918413296 1:184282801-184282823 CACTGAGGACTACTGGAGGGGGG + Intergenic
918483017 1:184999996-185000018 CAATGAGGTCTATTGGAGGGTGG - Intergenic
918725687 1:187919695-187919717 CACTGAGACCTACTGGAGGATGG - Intergenic
919361025 1:196595040-196595062 CATTGAAGATTATTGGAGATAGG + Intronic
919818757 1:201459516-201459538 CAGGCAGAACTATAGGAGGTAGG - Intergenic
920608889 1:207418104-207418126 CAATGAGAGCTGCTGGAGGTGGG - Intergenic
921807557 1:219473459-219473481 CAGAGAGATTTATTGGAGGTAGG + Intergenic
922682172 1:227609489-227609511 CATTGGGGCCTATTGGAGGGTGG - Intronic
923965753 1:239136710-239136732 CATTGCGAACAATTCGAGGAAGG - Intergenic
924171380 1:241345219-241345241 CATTGAGGCCTATCGGAGGGTGG + Intronic
1063155688 10:3377153-3377175 CATTGGCAACTATGGGAGATGGG - Intergenic
1063597945 10:7454203-7454225 CATTGAGGCCTATTGGAGAGTGG + Intergenic
1063795346 10:9508110-9508132 CACTGGGGCCTATTGGAGGTTGG + Intergenic
1067138550 10:43633945-43633967 CATTGGGGCCTATTGGAGGTTGG - Intergenic
1068101386 10:52558541-52558563 CACTGAGGCCTATTGGAGGGTGG - Intergenic
1068531083 10:58187346-58187368 CACTGGGAACTACTGGGGGTGGG - Intergenic
1069551345 10:69366579-69366601 CATTTAGACATGTTGGAGGTGGG - Intronic
1071234984 10:83634727-83634749 CATTGAGGTTTATTGGAGGGTGG - Intergenic
1071772352 10:88743705-88743727 CATTGAGAGTGAATGGAGGTAGG + Intronic
1072882110 10:99237642-99237664 CATAGTGAAGTATTGGATGTTGG + Intergenic
1077449912 11:2634372-2634394 CAATGAGAACACTTGGACGTAGG - Intronic
1077971422 11:7195590-7195612 CACTGTGAACTACTGGAGGAGGG + Intergenic
1080152478 11:29069597-29069619 CACTGGGACCTATTGGAGGGTGG + Intergenic
1082806134 11:57452330-57452352 AATTGAAAATTATTGAAGGTTGG - Intergenic
1083102735 11:60326794-60326816 CATTGATAAGTATAGGAGGCAGG - Intergenic
1085809103 11:79664574-79664596 CACTGGGACCTATTGGAGGGTGG + Intergenic
1086461335 11:87008681-87008703 CACTGGGGACTATTGGAGGCTGG - Intergenic
1087848844 11:103004934-103004956 CACTGGGACCTATTGGAGGGTGG + Intergenic
1088116597 11:106319616-106319638 CAATGAGAACAATTAGAGGTTGG - Intergenic
1089021705 11:115222246-115222268 CATGGAGGATTATTGGAGTTTGG + Intronic
1089180002 11:116576937-116576959 CATGCTGACCTATTGGAGGTTGG - Intergenic
1090223290 11:125050115-125050137 CACTGACCACTATTTGAGGTGGG + Intergenic
1091763182 12:3101167-3101189 TATGGAGTACTATTGGAGGGGGG + Intronic
1091875042 12:3926621-3926643 CACTGAGGACTACTAGAGGTGGG + Intergenic
1092514157 12:9190528-9190550 CATTGAGGCCTATTGGAGGGTGG + Intronic
1095636727 12:44442914-44442936 CATTGACAATTACTGGATGTAGG - Intergenic
1096655740 12:53090550-53090572 CATTGAGAGCTCTTTCAGGTTGG + Intergenic
1096966049 12:55628715-55628737 GATTCAGTACTATTGGAGGATGG - Intergenic
1098169161 12:67728801-67728823 CTTTAAGAACTAGGGGAGGTGGG - Intergenic
1099371956 12:81845081-81845103 CATTGAGGACTACTAGAGGGGGG - Intergenic
1099636184 12:85215508-85215530 CATTGGGGCCTATTGGAGGTTGG - Intronic
1099732246 12:86520227-86520249 CACTGGGACCTATTGGAGGGTGG - Intronic
1099815734 12:87645020-87645042 CATAGAGAACTTTTGGAAGCTGG - Intergenic
1100916092 12:99423822-99423844 CACTGGGACCTATTGGAGGGTGG + Intronic
1101060402 12:100965305-100965327 ACTTGAGATCTAGTGGAGGTAGG - Intronic
1101264814 12:103073161-103073183 CAGTGGGACCTATTGGAGGATGG + Intergenic
1101741758 12:107505691-107505713 CATTGGGACCTATTGGAGAGTGG - Intronic
1101865639 12:108517717-108517739 CACAGAGAACTGGTGGAGGTGGG - Intronic
1104344036 12:127979701-127979723 CACTGGGGACTACTGGAGGTGGG + Intergenic
1105592922 13:21811170-21811192 CCTTGGAAACTACTGGAGGTTGG + Intergenic
1107410438 13:40153156-40153178 AATTGAGAAATATTGCAGGTTGG + Intergenic
1108794452 13:54014324-54014346 CAATTAGAACTTTTGGAGGCCGG - Intergenic
1109177565 13:59175056-59175078 CTTTGATAACTAGTGGAGCTTGG - Intergenic
1109451765 13:62524129-62524151 CATTGAAAATTATTAGAGGCAGG + Intergenic
1109520845 13:63508656-63508678 CACTGGGGACTTTTGGAGGTTGG - Intergenic
1110242348 13:73283138-73283160 CATTCATAGGTATTGGAGGTTGG - Intergenic
1111177554 13:84616549-84616571 CATTGAGATCTATTTGAGCTAGG - Intergenic
1111338577 13:86853701-86853723 CACTGAGACCTATTTGAGGGAGG + Intergenic
1113101272 13:106722100-106722122 CAATGAGAACACTTGGACGTAGG + Intergenic
1113395610 13:109944805-109944827 CACTGAGGGCTATTGGAGGGTGG + Intergenic
1114754365 14:25242719-25242741 CATTGGGGCCTATTGGAGGAGGG + Intergenic
1115063220 14:29220382-29220404 CTTTGAAAAATATTAGAGGTTGG + Intergenic
1115933004 14:38519070-38519092 CACTGAGGCCTATTGGAAGTTGG + Intergenic
1119221935 14:72915924-72915946 TATTGAGAACAATGGGAGATGGG - Intergenic
1119793060 14:77370669-77370691 CATTGATTGCTTTTGGAGGTAGG - Intronic
1120058972 14:79959519-79959541 CAATGAGGCCTGTTGGAGGTGGG + Intergenic
1120536343 14:85700775-85700797 CACTGGGAACTATTGGAGGGTGG + Intergenic
1121711431 14:96041604-96041626 CACTGCGAAGTATTGCAGGTAGG - Intronic
1135180087 16:20265294-20265316 CATTGGGGCCTATTGGAGGGTGG - Intergenic
1135336379 16:21605034-21605056 CACATAGAACTCTTGGAGGTTGG + Intronic
1137833387 16:51566443-51566465 CATTGGGAACTTTTTCAGGTTGG - Intergenic
1139235278 16:65331691-65331713 CACTGGGATCTATTGGAGGGTGG - Intergenic
1139479780 16:67223947-67223969 CATTGGGGACTGTTAGAGGTGGG + Intronic
1140633496 16:76882828-76882850 CATCTAGAACTACTGGAGGGAGG - Intergenic
1141211485 16:81984790-81984812 CACTGAGGACTAATAGAGGTGGG + Intergenic
1144231691 17:13211815-13211837 CACTGAGGCCTATTGGAGGGTGG + Intergenic
1144797558 17:17902557-17902579 CATATAGAACTGTTGGGGGTAGG + Intronic
1145727099 17:27139894-27139916 CAGTGAGGCCTATTGAAGGTTGG + Intergenic
1146129812 17:30262397-30262419 TATTGATAACTACTGAAGGTGGG + Intronic
1147394610 17:40132081-40132103 CCTTCAGACCTTTTGGAGGTAGG + Exonic
1148635985 17:49150049-49150071 CATTTAAAAATTTTGGAGGTCGG + Intronic
1148921046 17:51034498-51034520 CATTGAGAGCTCTTTCAGGTTGG - Intronic
1149126430 17:53239674-53239696 CATTTTGAAGTATTGGAGGTTGG + Intergenic
1149130992 17:53302538-53302560 CATTGAGAGCAAATGGAGGAAGG + Intergenic
1150306231 17:64087605-64087627 CATTGATAATTATTGAAGCTGGG + Intronic
1153012847 18:555516-555538 CACTCAGAAGTATTGGAGTTGGG + Intergenic
1156764554 18:40636025-40636047 TATTTAGAAATATTGGGGGTGGG - Intergenic
1161536576 19:4822923-4822945 CATTCTGAGCTACTGGAGGTTGG - Intronic
1161775475 19:6259833-6259855 CATTGAGCCCTTTTGGAGGATGG - Intronic
1164329803 19:24243604-24243626 CACAAAGAATTATTGGAGGTCGG + Intergenic
1165127345 19:33608479-33608501 AATTAAGAATTATTGGAGGTTGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165569035 19:36759618-36759640 CATTGATAACTACTGCAGCTAGG + Intronic
1165988654 19:39792863-39792885 CATTGAGAATTGTTGGTGGCAGG + Intergenic
928857573 2:35818126-35818148 CATTTAGAATTATTGGTGGATGG - Intergenic
929078955 2:38103571-38103593 CATTGGGACCTATTTGAGGGTGG + Intronic
929357589 2:41044636-41044658 CACTGAGGCCTATTGGAGGGTGG + Intergenic
930347063 2:50196892-50196914 CACTGAGATCTATTTGAGGGTGG + Intronic
930526217 2:52533616-52533638 CATTGGGAACTTTTTCAGGTTGG - Intergenic
931118675 2:59192549-59192571 CATTGAGATCCATTAGAGGGTGG + Intergenic
931518868 2:63073427-63073449 CACTGAGGACTACTAGAGGTAGG + Intergenic
933150096 2:78903988-78904010 CACTGAGGCCTATTGGAGGGTGG - Intergenic
937725313 2:125157482-125157504 CATTGGGGCCTATTGGAGGATGG - Intergenic
939838786 2:147161713-147161735 CATTTAGAATTATGGTAGGTGGG - Intergenic
941116152 2:161474607-161474629 CATTAAGAAGTATAGGAAGTTGG - Intronic
941287372 2:163630843-163630865 CATTTAGAACTATTAAAGATTGG + Intronic
942272591 2:174291894-174291916 CAATGAGAACTCTTGGACATAGG + Intergenic
944285681 2:197947445-197947467 CTTTGAGAACCACTGGAGCTGGG + Intronic
946459919 2:219859744-219859766 CATTGAAATCTATGGGTGGTAGG + Intergenic
947325839 2:228975647-228975669 CACTGTGGACTACTGGAGGTGGG + Intronic
1171333323 20:24360513-24360535 CACTGGGAACTACTAGAGGTGGG + Intergenic
1172220696 20:33272950-33272972 CATTGTAAACTATTGGAGGGAGG + Intergenic
1176978438 21:15351418-15351440 CACTGAGAACTACCAGAGGTGGG + Intergenic
1177369554 21:20183821-20183843 CTGGGAGAAATATTGGAGGTAGG + Intergenic
1177457860 21:21366776-21366798 TATTGATAACTATTGAAGCTGGG - Intronic
1177791091 21:25722564-25722586 CATTATGAGGTATTGGAGGTTGG + Intronic
1178132999 21:29594483-29594505 CAGTGAGAAGTAGTGGAGGGTGG + Intronic
1182345114 22:29657535-29657557 CATTGAGAGCATTTGGAGATTGG + Intronic
1182375136 22:29841286-29841308 CCTTGAGATCTCTTGGAGCTTGG - Intergenic
949662486 3:6295231-6295253 CATTAAGAAATATTGTAGTTGGG + Intergenic
950435627 3:12977872-12977894 GATTGAGAATTAATGGAGGCAGG + Intronic
951900044 3:27647721-27647743 CATTGGGAACTGTTTCAGGTTGG + Intergenic
951983144 3:28587715-28587737 CACTGGGGCCTATTGGAGGTTGG + Intergenic
952528671 3:34240953-34240975 CATTGAGCACTATAGCAGGCAGG + Intergenic
953039486 3:39242678-39242700 CACTGAGGCCTATTGGAGGATGG + Intergenic
953839834 3:46380779-46380801 GAATCAGAACTATTTGAGGTTGG - Intergenic
954513305 3:51147534-51147556 CATTGAGAACTCTTGGACATAGG - Intronic
955140291 3:56261869-56261891 CACTGGGGACTATTGGAGGGTGG - Intronic
955268339 3:57469815-57469837 CACTGGGAACTACTAGAGGTGGG + Intronic
955841900 3:63121444-63121466 GATTGGGAACTATTTTAGGTGGG - Intergenic
955937805 3:64119205-64119227 CACTGGGATCTATTGGAGGGTGG + Intronic
955975066 3:64472081-64472103 CACAGAGCACTATTTGAGGTTGG - Intergenic
958756136 3:98251370-98251392 CACTGGGACCTATTGGAGGATGG + Intergenic
959176344 3:102916643-102916665 CTTTGAGAGCTTTTGCAGGTGGG - Intergenic
959428936 3:106227849-106227871 CACTGAGAACTACTGGGGGGTGG + Intergenic
959766745 3:110039917-110039939 CATTGAGGTCTGTTGGAGCTTGG - Intergenic
960821950 3:121743449-121743471 CACTGGGACCTGTTGGAGGTTGG + Intronic
962221693 3:133569799-133569821 CATTGAAAACTCTTGAAGGCAGG - Intergenic
962957665 3:140280950-140280972 TATTGAGAAGGATTTGAGGTAGG + Intronic
962982072 3:140499663-140499685 CAGTGAGAAGTATTTGAGGATGG - Intronic
966245260 3:177801261-177801283 CATTGGGGACTATTAGAGGGTGG + Intergenic
966523069 3:180894241-180894263 CATTGAGAGCTCTTTCAGGTTGG + Intronic
967386395 3:188915717-188915739 CATTGGGAACTTTTGAAGGGTGG - Intergenic
971065952 4:23033529-23033551 CACTGGGAACTAATTGAGGTGGG - Intergenic
971675803 4:29627780-29627802 CATTGGGGACTACTGGAGGGAGG - Intergenic
972223693 4:36986772-36986794 CACTGGGTCCTATTGGAGGTTGG - Intergenic
972625419 4:40793000-40793022 CATTGAGAAATATATGAAGTTGG + Intronic
973236962 4:47915538-47915560 CATTGAAAACGCTTTGAGGTTGG + Intronic
974253172 4:59415248-59415270 CATTGTGAACTAATGGATTTGGG - Intergenic
974697047 4:65389733-65389755 CATTGAGAACTATTGGAGGTAGG + Intronic
974999650 4:69206458-69206480 CACTGAGATGTATTGGAGGGTGG + Intronic
975015787 4:69417101-69417123 CACTGAGATGTATTGGAGGGTGG - Intronic
976429881 4:84950233-84950255 CATTGGGAGCTATCGGGGGTTGG + Intronic
978126284 4:105139573-105139595 CAGTGAGAACTATTGAAGAAGGG - Intergenic
978162017 4:105559947-105559969 CATTGAGAAAAATAGGTGGTAGG + Intronic
978400029 4:108321615-108321637 CATTTAGAACTGTTGGATGAAGG + Intergenic
978737204 4:112097484-112097506 CATTGGGGACTACTAGAGGTGGG + Intergenic
979158070 4:117423334-117423356 CATTTAGGCCTACTGGAGGTTGG - Intergenic
980025704 4:127763754-127763776 CATTGTGAAGTATTTTAGGTTGG + Intronic
980159276 4:129139518-129139540 CAATGAGAACTGTTGGCGTTTGG - Intergenic
980755509 4:137154296-137154318 CGTTGGGGCCTATTGGAGGTTGG - Intergenic
981856136 4:149295195-149295217 CATTCTGAAGTATTGGAGGTTGG - Intergenic
984124408 4:175788772-175788794 CATTAAGAACTATTAAAGGGTGG - Intronic
984542292 4:181054698-181054720 CATTGGGAACTATTAGAGCAAGG + Intergenic
985212533 4:187610307-187610329 CATTGGGGCCTATTGGGGGTTGG + Intergenic
985668946 5:1196652-1196674 AATTGAGTACTATGGGAGTTAGG + Intergenic
985932691 5:3071112-3071134 CACTGGGACCTATTGGAGGGGGG - Intergenic
986433085 5:7701166-7701188 AAATGAGTACTATTGGAGGGAGG + Intronic
986567034 5:9125501-9125523 CATTGGGACCTGTTGGAGGGTGG - Intronic
986866703 5:11997783-11997805 CACTGAGGACTACTAGAGGTGGG + Intergenic
986973767 5:13370997-13371019 CACTGTGAACTATTAGAGATGGG + Intergenic
988619389 5:32807222-32807244 CATTGAGACCTATTGGAGGGCGG - Intergenic
990194454 5:53298477-53298499 CACTGGGACCTATTGGAGGGTGG - Intergenic
992161335 5:74006546-74006568 CACTGAGGACTACTGGAGGGAGG - Intergenic
994292591 5:98046593-98046615 TATTGAGAACTAATGTAGATTGG + Intergenic
994554170 5:101276331-101276353 CATTGAAAAATATTGTAGGATGG + Intergenic
995738628 5:115330537-115330559 CACTGGGGACTACTGGAGGTGGG + Intergenic
996054412 5:118967565-118967587 CATTGAGAACTCTTTCAGGTTGG - Intronic
996698924 5:126429368-126429390 CACTGGGATCTATTGGAGGGTGG + Intronic
997017438 5:129953135-129953157 CATTGGGACCTGTTGGGGGTAGG - Intronic
999624466 5:153505741-153505763 CATGGAGCACTATTGTAGCTAGG + Intronic
1000372633 5:160551760-160551782 CAATGGGACCTATTGGAGGGTGG - Intergenic
1000745408 5:165026628-165026650 CATTGGGGACTACTGGTGGTGGG + Intergenic
1001279503 5:170376523-170376545 CACTGAGGCCTATTGGAGGGCGG - Exonic
1002107838 5:176888922-176888944 CTTTGGGAACTCTTGGAGGTAGG - Intronic
1002370055 5:178744809-178744831 CACTGGGAACTACTGGAGGATGG + Intergenic
1004011218 6:11689752-11689774 CACTGAGGCCTATTGGAGGGTGG + Intergenic
1005764458 6:28997179-28997201 ATTTGAGAACTAGTGGTGGTGGG + Intronic
1005902526 6:30229598-30229620 CATTGAGGTCTATTTGAGGATGG - Intergenic
1007086910 6:39154703-39154725 CATTGAGAACAAATGCATGTAGG - Intergenic
1008083954 6:47224154-47224176 CATTGGGGCCTATTGGAGGTTGG + Intergenic
1008084334 6:47228442-47228464 CATTGGGGCCTATTTGAGGTTGG + Intergenic
1008598894 6:53069850-53069872 CATTGATAATTATTGAAGTTGGG + Intronic
1008688584 6:53951753-53951775 CATTGGGACCTATTGGAGGGTGG + Intronic
1011732717 6:90282312-90282334 CACTGAGACCTATTAGAGGGTGG - Intronic
1013330720 6:109097298-109097320 AATGGAGAACTAATGGAGGAGGG - Intronic
1013413517 6:109903768-109903790 CATTTAGAACTATTTTAGATTGG - Intergenic
1014580033 6:123125994-123126016 CACTGGGACCTGTTGGAGGTGGG - Intergenic
1014660282 6:124161778-124161800 CATTGAGGACTACTGGAGAGGGG + Intronic
1014905653 6:127023875-127023897 CACTGGGGCCTATTGGAGGTTGG - Intergenic
1018356554 6:163023231-163023253 CACTGAGGACTACTGGAGGGTGG - Intronic
1019039668 6:169093461-169093483 CACTGAGAAATATGGCAGGTGGG - Intergenic
1021177120 7:17461805-17461827 CATTTAGAACTATGGGAGCAGGG + Intergenic
1021536389 7:21709407-21709429 CACTGAGGCCTATTAGAGGTGGG + Intronic
1021940784 7:25677200-25677222 CATTGAGAAGTGTTGGATGGAGG - Intergenic
1022890842 7:34697092-34697114 TATTGATAACTGTTGGAGGTTGG + Intronic
1025080815 7:55980889-55980911 CCTTGGGGAGTATTGGAGGTTGG + Intronic
1027651397 7:80873035-80873057 CTTTGAGAACTACTGGAAGAAGG + Intronic
1028039553 7:86032644-86032666 CATTGACAACTCTTTCAGGTTGG + Intergenic
1028951634 7:96643108-96643130 CACTGGGACCTATTGGAGGTTGG - Intronic
1030097902 7:105917339-105917361 CACTGAGAACTATTAGAGGGAGG - Intronic
1030388062 7:108890573-108890595 CATTGGGAACTACTGGAGCAGGG + Intergenic
1030720406 7:112864224-112864246 CATTGAAACCTATTGGAGGGTGG + Intronic
1030935586 7:115581876-115581898 CATTGTGCACTGTTGGGGGTGGG - Intergenic
1031865916 7:127039174-127039196 CATTCTGAGCTACTGGAGGTTGG - Intronic
1032905150 7:136356197-136356219 CATTGAAGCCTATTGGAGGGTGG + Intergenic
1033041289 7:137920833-137920855 CATTCTGAACTACTGGAGGTTGG + Intronic
1037222859 8:16546469-16546491 TATTAAGAACTCTTGGGGGTAGG + Intronic
1037466546 8:19166976-19166998 ACTTGAGAAATATTGGAGGATGG + Intergenic
1038334182 8:26633196-26633218 CATTGGGAGCTATTGGGGGCAGG + Intronic
1038821945 8:30960073-30960095 CATTGAGAACTATTAAGGGTTGG + Intergenic
1039019805 8:33192459-33192481 CATTGTGAAATACTGTAGGTAGG - Intergenic
1040870424 8:52094892-52094914 CTTCGGGAACTATTGGAGGAAGG + Intergenic
1041560239 8:59209259-59209281 CACTGAGGACTACTGGAGGGTGG - Intergenic
1044840921 8:96336409-96336431 CATTGAGAAGTGGAGGAGGTTGG + Exonic
1045317536 8:101056285-101056307 TATTGAGCAATATTGGAGATAGG - Intergenic
1045554212 8:103199815-103199837 CACTGAGGCCTATTGGAGGGTGG - Intronic
1046505793 8:115136446-115136468 CACTGAGGTCTGTTGGAGGTTGG - Intergenic
1046645461 8:116781219-116781241 CAGTGAGAAATAATGGAGGATGG - Intronic
1046856165 8:119034227-119034249 CACTGGGACCTATTGGAGGATGG + Intronic
1046989104 8:120429332-120429354 CACTGAGGCCTATTGGAGGGTGG + Intronic
1048078549 8:131099995-131100017 AATTGAGAACAAGTGGTGGTTGG - Intergenic
1048460119 8:134614561-134614583 TATTGTGACCTCTTGGAGGTTGG + Intronic
1049506359 8:143001802-143001824 CACTGGGGCCTATTGGAGGTTGG - Intergenic
1050224815 9:3441608-3441630 CATTGAGAGCTCTTTTAGGTTGG - Intronic
1050487378 9:6148424-6148446 TATTGATGACTTTTGGAGGTGGG + Intergenic
1051498619 9:17752866-17752888 CACTGGGACCTATTGGAGGGTGG - Intronic
1052978943 9:34433240-34433262 CATTGAGAACACTTTCAGGTTGG + Intronic
1053234674 9:36442324-36442346 CAATGACTACTATTGGAGCTTGG + Intronic
1056851671 9:90089899-90089921 GATTTAAAACAATTGGAGGTTGG - Intergenic
1058332866 9:103785858-103785880 CACTGGGACCTATTGGAGGGTGG + Intergenic
1058435929 9:104963339-104963361 CACTGAGAACTAAAGCAGGTAGG - Intergenic
1060318043 9:122531233-122531255 CATTTAGAATTATTGGAAGGAGG + Intergenic
1060382495 9:123189644-123189666 CAATGAGAACTCTTGGACATAGG + Intronic
1062171813 9:135138906-135138928 CAAGGAGAAGTATTTGAGGTGGG - Intergenic
1186009602 X:5114873-5114895 CATTGGGGCCTATTGGAGGGTGG + Intergenic
1186163232 X:6800395-6800417 TATTAAGAACTGTTGGTGGTGGG - Intergenic
1186209779 X:7237842-7237864 CATTGAAGACTATTGAAGATGGG - Intronic
1187076422 X:15939574-15939596 CATTGAGAACACATGGAGATAGG - Intergenic
1187184908 X:16974872-16974894 CACTGAGGCCTATTGGAGGATGG - Intronic
1188677078 X:32954698-32954720 CATTGGGACCTGTTGGAGGGTGG - Intronic
1190185969 X:48234505-48234527 CACAAAGAACTATTGGGGGTGGG + Intronic
1190843003 X:54163818-54163840 CATTGATAACAATTGAAAGTGGG - Intronic
1191860643 X:65664305-65664327 CACTGAAAACTACTAGAGGTGGG + Intronic
1191894471 X:65977182-65977204 CACTGGGACCTATTAGAGGTTGG - Intergenic
1193160713 X:78226058-78226080 CACTGAGACCTGTTGGGGGTGGG - Intergenic
1193484440 X:82069397-82069419 CATTGGGGCCTATTGGAGGGGGG - Intergenic
1193773750 X:85619408-85619430 CAGTGAGAAGTAGTGGAGGCAGG - Intergenic
1194272422 X:91833007-91833029 CACTGGGGCCTATTGGAGGTTGG - Intronic
1194801305 X:98276826-98276848 CATTGGGAACTACTGGATGGGGG + Intergenic
1197076343 X:122357919-122357941 CACTGGGGACTATTGGAGGTTGG - Intergenic
1198867695 X:141142148-141142170 CATTAACAAATATTAGAGGTGGG - Intergenic
1200589666 Y:5054435-5054457 CACTGGGGCCTATTGGAGGTTGG - Intronic
1201557647 Y:15281374-15281396 TATTAAGAACTATTGGTGGTGGG - Intergenic