ID: 974699650

View in Genome Browser
Species Human (GRCh38)
Location 4:65424052-65424074
Sequence GGTGGGACTCACCATTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974699650 Original CRISPR GGTGGGACTCACCATTAGAG TGG (reversed) Intronic