ID: 974699650

View in Genome Browser
Species Human (GRCh38)
Location 4:65424052-65424074
Sequence GGTGGGACTCACCATTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974699650 Original CRISPR GGTGGGACTCACCATTAGAG TGG (reversed) Intronic
902100190 1:13982017-13982039 GGTGGGAATCAACATTGAAGTGG - Intergenic
904203571 1:28837701-28837723 GGTGAGACTCTCCATAAAAGAGG - Intronic
914910761 1:151784285-151784307 GATGGGACTATCCAGTAGAGAGG - Intronic
1067727569 10:48782134-48782156 GGCTGGACTTATCATTAGAGAGG + Intronic
1090440188 11:126718884-126718906 GCTGGGATTCAGCATCAGAGAGG - Intronic
1091976556 12:4830469-4830491 AGTGGGACTCACCACTGCAGGGG - Intronic
1095825161 12:46523538-46523560 GGTGGGACTAAGAATTATAGAGG - Intergenic
1099816948 12:87661495-87661517 GGTGGGACTTAAAATTAGAGAGG + Intergenic
1099977921 12:89565829-89565851 GGTGAGACTGAAGATTAGAGTGG + Intergenic
1108968960 13:56347983-56348005 GGTGGGACTCAAGATGACAGAGG + Intergenic
1115780859 14:36766504-36766526 TGTGGGACCCAGCATGAGAGTGG - Intronic
1116427611 14:44809650-44809672 GGGGGCATTCACCTTTAGAGTGG - Intergenic
1121211600 14:92211555-92211577 GGGGGGCCTCACCATTATGGTGG + Intergenic
1125214999 15:37262020-37262042 GCTGGGTCTCACAATTAGGGAGG + Intergenic
1129109105 15:73327490-73327512 GGTGGGGCTCAGCATGTGAGTGG - Intronic
1133955925 16:10443854-10443876 GCTAGGACTGACAATTAGAGGGG + Intronic
1135118436 16:19743726-19743748 TGTGTGACTGACCATCAGAGTGG - Intronic
1135660965 16:24296206-24296228 GGTGGGAGTCACCCTGAGGGTGG - Intronic
1137367123 16:47870316-47870338 GGTGGTACTCAGCAGTGGAGTGG - Intergenic
1139630188 16:68226573-68226595 AGTGGGACCCACCATTTGTGGGG + Exonic
1144028351 17:11298294-11298316 AGTGGGACACACAATAAGAGAGG + Intronic
1144759280 17:17698306-17698328 GGTGGGACTCAACTCTTGAGTGG - Intronic
1151904621 17:77039577-77039599 GCTGGGAGTCACCATTTGAGGGG - Intergenic
1155647680 18:28099838-28099860 GGTAGGTATCACCTTTAGAGTGG + Intronic
1157480702 18:48051779-48051801 GGCGGGACACACCAATGGAGAGG + Intronic
1158264129 18:55640897-55640919 GGATGGACTCAACACTAGAGTGG + Intronic
936394943 2:112118414-112118436 GGTGGGTCTCACTGTTAGTGAGG + Exonic
940436910 2:153666447-153666469 GCTAGGACTCCCCATTGGAGTGG + Intergenic
948296010 2:236861207-236861229 GCTGGGACTCATCAGCAGAGGGG + Intergenic
1171295298 20:24012049-24012071 GGTAGGACACCCCATGAGAGTGG + Intergenic
1172046443 20:32084033-32084055 GGTGGGACTCACTCTTGTAGTGG - Exonic
1180128186 21:45805989-45806011 GCTGTGTCTCAGCATTAGAGAGG + Intronic
1180956705 22:19744465-19744487 GGTCGGCCTGACCCTTAGAGAGG - Intergenic
1182575195 22:31268190-31268212 GGTGGGACTCACCATTCCGGAGG - Exonic
1183025824 22:35065435-35065457 AGAGGGACTCACCCTGAGAGAGG - Intergenic
1184256704 22:43291034-43291056 GGCTGTACTCACCATTGGAGCGG + Exonic
1184415172 22:44348000-44348022 GGTGGGGGTCAGGATTAGAGTGG - Intergenic
1185294459 22:50046398-50046420 GGTAGCACGCGCCATTAGAGAGG + Intronic
953703397 3:45213634-45213656 GCTGGGACTCTCCATTTCAGTGG + Intergenic
955030016 3:55206976-55206998 TCTGGGGCTCACCATTAGAGTGG - Intergenic
955786964 3:62551037-62551059 GGTTGGCATCACCATGAGAGAGG - Intronic
956818931 3:72934912-72934934 GGAAGGATTCCCCATTAGAGTGG + Intronic
966927187 3:184652439-184652461 TGTGGGCCTCACCATAAGGGAGG - Intronic
970915497 4:21328858-21328880 GGTGGTACTCACCATTGGCCTGG - Intronic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
977259605 4:94783023-94783045 GGTTGCACCCACCATTAGAGAGG - Intronic
981296664 4:143140679-143140701 GGAGGGGCCCACCATTACAGAGG + Intergenic
1006408010 6:33856351-33856373 GGTGGGAGTCACTCTTGGAGAGG - Intergenic
1018908303 6:168087877-168087899 GGTTGGAAGCACCATGAGAGGGG - Intergenic
1023761864 7:43471705-43471727 GGAGGCAGTCACCATCAGAGAGG + Intronic
1028196396 7:87912569-87912591 TGTGTGACTCTCCATTAAAGAGG + Intergenic
1029349159 7:100000764-100000786 GGAGGGTCTCACCATTCGGGAGG - Intergenic
1029714378 7:102317952-102317974 GGTGGGGTTCAGCATTGGAGGGG + Intronic
1032847039 7:135759935-135759957 GGTTGGAGTCACCATTATTGTGG - Intergenic
1037693784 8:21206400-21206422 GGTGGAATTCACCATGCGAGAGG + Intergenic
1041866397 8:62579534-62579556 TGTAGGTCTCAGCATTAGAGAGG + Exonic
1046111749 8:109733974-109733996 GGTGGGGTGCAGCATTAGAGAGG + Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048302282 8:133260407-133260429 GGTGGGACCCACTGTCAGAGTGG - Intronic
1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG + Intronic
1050480414 9:6081920-6081942 GGTGGGACTCAAAATAAAAGAGG - Intergenic
1052546157 9:29882696-29882718 AGTGGGACAAAACATTAGAGGGG - Intergenic
1054746676 9:68860835-68860857 GCTGGGACTCACCTCTAGGGAGG - Intronic
1190047664 X:47125634-47125656 GATTGGACTCACCATTACATTGG + Intergenic
1190635365 X:52427403-52427425 AGTGAGACTCACCATAAGGGTGG - Intergenic
1192682088 X:73262877-73262899 GGTGGGACTCAAAATAAAAGAGG + Intergenic
1192915678 X:75648955-75648977 GGTGGAACACATCATCAGAGCGG - Intergenic
1201972720 Y:19814823-19814845 GGTGGGACTCAAAATAAAAGCGG + Intergenic