ID: 974700638

View in Genome Browser
Species Human (GRCh38)
Location 4:65440828-65440850
Sequence CTCCCTATGGGTGTCTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974700630_974700638 9 Left 974700630 4:65440796-65440818 CCTTGTCTCCGGAGCCATTTTTA 0: 1
1: 0
2: 1
3: 13
4: 130
Right 974700638 4:65440828-65440850 CTCCCTATGGGTGTCTTCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 138
974700633_974700638 -5 Left 974700633 4:65440810-65440832 CCATTTTTAGTGGCCCATCTCCC 0: 1
1: 0
2: 1
3: 8
4: 131
Right 974700638 4:65440828-65440850 CTCCCTATGGGTGTCTTCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 138
974700632_974700638 1 Left 974700632 4:65440804-65440826 CCGGAGCCATTTTTAGTGGCCCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 974700638 4:65440828-65440850 CTCCCTATGGGTGTCTTCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974700638 Original CRISPR CTCCCTATGGGTGTCTTCAG AGG Intronic
901784642 1:11616757-11616779 CTCCCTCAGGGGGTCCTCAGTGG - Intergenic
902120034 1:14156712-14156734 CAGCCTATGTGTGTCTTCATAGG + Intergenic
902696619 1:18144576-18144598 CTACCTAGTGGTATCTTCAGGGG - Intronic
904874408 1:33643168-33643190 CTCCCTGTGGAGGTCCTCAGTGG + Intronic
908039353 1:60091471-60091493 CTCTCCATGGGGGTGTTCAGTGG + Intergenic
908148934 1:61279585-61279607 CTCCCTAAAGATGTCTCCAGAGG + Intronic
911463754 1:98224329-98224351 CTCCATATGGAGCTCTTCAGGGG - Intergenic
911987934 1:104654973-104654995 CAGCCTATGTGTGTCTTCATAGG + Intergenic
912710139 1:111944205-111944227 CTCCCTATGGGTCTCCACAAGGG - Intronic
914745191 1:150496490-150496512 ATCCTTATGGAGGTCTTCAGGGG + Exonic
915521157 1:156444989-156445011 CTCCCTCCTGCTGTCTTCAGTGG - Intergenic
915889860 1:159762990-159763012 CTCCATGTGGGGGTTTTCAGTGG + Intergenic
919972937 1:202592356-202592378 CCCCCCATGGGAGTCATCAGTGG - Exonic
921303273 1:213770687-213770709 CTCAATCTGGGTGACTTCAGAGG + Intergenic
1063999009 10:11647399-11647421 CTCTCTATGGGTGTGTTTATAGG + Intergenic
1067132993 10:43582892-43582914 CAGTCTATGCGTGTCTTCAGAGG + Intergenic
1075454345 10:122575470-122575492 CAGCCCATGAGTGTCTTCAGAGG + Intronic
1077046688 11:549822-549844 CTGCCTTTGGCTGTCTTCAGGGG - Intronic
1077979208 11:7282614-7282636 CAGCCTAGAGGTGTCTTCAGTGG + Intronic
1079808543 11:24964078-24964100 CTCCATATGGTTTTCTTCAATGG + Intronic
1087406025 11:97732040-97732062 CTCCCTACAGGAGTTTTCAGAGG + Intergenic
1089193426 11:116673081-116673103 CAGCCTATGGGTGTCTTTATAGG - Intergenic
1089254525 11:117187278-117187300 CTCCCTGTGGCTGTCTTCTCTGG + Intronic
1093794958 12:23300568-23300590 CTCTCTAAGGATGTTTTCAGGGG + Intergenic
1095949503 12:47773988-47774010 CTCCCTGTGGGTCTCAGCAGAGG - Intronic
1096761141 12:53842934-53842956 CTCTCTCTGGATGACTTCAGAGG + Intergenic
1102185581 12:110945716-110945738 CTCCATCTGGGTCTCTTCAAAGG + Intergenic
1104111813 12:125711330-125711352 CTCCTTCTGGGTGGCCTCAGGGG - Intergenic
1105358685 13:19685880-19685902 CTCCCTTTACATGTCTTCAGAGG + Intronic
1105604731 13:21917563-21917585 CTCCCTGTGTGTCTCTTCATTGG + Intergenic
1106189680 13:27440257-27440279 TTCATTCTGGGTGTCTTCAGCGG + Exonic
1107154068 13:37146056-37146078 CTCCAGGTTGGTGTCTTCAGAGG - Intergenic
1109733787 13:66453622-66453644 GTCCCCATGGGTGTCCACAGTGG - Intronic
1112002879 13:95228179-95228201 CTCCCTCTGGGTTTTCTCAGTGG - Intronic
1113307621 13:109095222-109095244 CTAAATATAGGTGTCTTCAGTGG + Intronic
1113626355 13:111850723-111850745 CTCCCTAGGGTTGTCTCCAAGGG + Intergenic
1114803925 14:25811947-25811969 CTCACTATGGGAGTCTCAAGAGG - Intergenic
1115948945 14:38697504-38697526 CAGTCTATGGGTGTCTTCATGGG - Intergenic
1118721884 14:68600274-68600296 CTCCCTTTGGCTGGCCTCAGGGG + Intronic
1120353488 14:83395555-83395577 TTCTCTAAGGGTGTTTTCAGAGG - Intergenic
1121102538 14:91259972-91259994 CTGCCAATGGTTTTCTTCAGGGG - Intergenic
1124425329 15:29558267-29558289 CTCCCGTGGGGTGGCTTCAGAGG - Intronic
1124794476 15:32763520-32763542 CTCCACATGGGCGTCTTGAGTGG - Intergenic
1125477039 15:40054595-40054617 CTGACTCTGGGTGGCTTCAGAGG - Intergenic
1127377138 15:58395103-58395125 CTCCCTGTGGGTGATTTCAGAGG - Intronic
1132294656 15:100726335-100726357 GGCCCCATGGGTGTTTTCAGGGG + Intergenic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132937415 16:2488157-2488179 CTTCCTGTGGGCGCCTTCAGGGG + Intronic
1135190985 16:20354591-20354613 CTTATTATGGGTGTCTTCAAAGG + Intronic
1136225480 16:28857595-28857617 CTCCCTGTGTGTCTCTTCATTGG - Intronic
1138242953 16:55443791-55443813 GTCCTTTTGGGTGTATTCAGGGG + Intronic
1139206733 16:65036321-65036343 CTCCCTATGGCTTTATTCAAAGG + Intronic
1140222703 16:73055648-73055670 CACCGTGTGGGTGTCTTCACTGG - Intronic
1145185120 17:20787359-20787381 CCTCCTTTGGGTGTATTCAGAGG + Intergenic
1146985440 17:37212255-37212277 ATCCCTTTGGGAGTCTTCACAGG + Intronic
1151552647 17:74830970-74830992 CTGCCTATGGGTGTCCTCGGGGG + Intronic
1153153390 18:2121616-2121638 CTCCCTAAGGGTGTCTCTTGGGG - Intergenic
1159793871 18:72817881-72817903 TTCTATATGGGTGTCTTCACTGG - Intronic
1162140132 19:8580589-8580611 CTCCCTAAGGGTGGGTTCAAAGG + Exonic
1163609784 19:18294870-18294892 CACCCTGGGGGTGTCTTCTGAGG + Intergenic
1164232536 19:23302841-23302863 CTTCCTAGGGGTGTTTACAGAGG + Intergenic
1164505247 19:28854804-28854826 CTACCTCTGGTTGTCTTCTGGGG - Intergenic
1165907243 19:39201646-39201668 CTCCCTCCAGGTGTCTGCAGTGG + Exonic
925497622 2:4469749-4469771 CTCCCTGTGGGTGCCTGCATAGG - Intergenic
926339172 2:11890592-11890614 CTGCCTCTGGTTGTCTTCATGGG + Intergenic
926936036 2:18087328-18087350 CTCCCTCTGTGTTTCTGCAGAGG - Intronic
927929553 2:27035448-27035470 CTCCCTCTGGGCCTCCTCAGAGG + Intronic
932055700 2:68441187-68441209 CTGCCTATGCGAGTTTTCAGAGG + Intergenic
932140455 2:69272942-69272964 CTCCCTGAGGGTGTGTTGAGTGG - Intergenic
933671484 2:85011702-85011724 CTGCCAATGGGAGGCTTCAGAGG - Intronic
934620005 2:95798061-95798083 CTCCCTATCAAGGTCTTCAGAGG - Intergenic
934640883 2:96026496-96026518 CTCCCTATCAAGGTCTTCAGAGG + Intronic
935802679 2:106714454-106714476 CACTCTGTGGGTGTCTTCAAGGG - Intergenic
935822472 2:106908083-106908105 CTCCCTAATAGGGTCTTCAGAGG - Intergenic
935874164 2:107488259-107488281 CTCCCTATCCATGTCATCAGTGG - Intergenic
938087820 2:128412821-128412843 CTCAGTATGTGTGACTTCAGTGG - Intergenic
942074537 2:172344467-172344489 CTCTGTATGGGTTTCTTCACAGG + Intergenic
1168889857 20:1287968-1287990 TTCTCCATGGGTGTCTGCAGAGG + Intronic
1173012692 20:39196491-39196513 CTCCACATGGGTTTCTTCAGAGG + Intergenic
1175438836 20:58976216-58976238 CTCACTATGGGTTTCTCCATGGG + Intergenic
1175975273 20:62707760-62707782 CTCCCTCTGAGTGTCCTCACAGG - Intergenic
1177225807 21:18254026-18254048 CTCCCTCTGAGTGTCATCATAGG + Intronic
1178210539 21:30526404-30526426 CTCCATTAGGATGTCTTCAGGGG + Intergenic
1179806975 21:43845561-43845583 CTCCCTGTTGGGGCCTTCAGGGG + Intergenic
1180661823 22:17474424-17474446 CTCCCTATGTGTGTCCTTTGAGG + Intronic
1182833290 22:33321239-33321261 ATCCACATAGGTGTCTTCAGGGG - Intronic
1183031323 22:35108523-35108545 CTCCCTATTGGAGTGATCAGAGG - Intergenic
1184947956 22:47817791-47817813 CTCCTCATGGGTGTGTGCAGTGG - Intergenic
950188924 3:10962932-10962954 CTTCTGATGGGTGTGTTCAGAGG + Intergenic
951966505 3:28391749-28391771 CCCTCTCTGGGTGTCTGCAGTGG - Intronic
952218850 3:31304267-31304289 CTTCCTATTGGTGTCTAAAGTGG - Intergenic
952507833 3:34023819-34023841 CTTCTTATGGGGGTCTTTAGTGG + Intergenic
959973467 3:112432305-112432327 CTCCCTCTGGCTGCCTTCACAGG - Intergenic
960293529 3:115915159-115915181 TTCCCTTTGGTTTTCTTCAGTGG + Intronic
961053588 3:123767794-123767816 ATGCCTGTGGGTGTCTTCAGGGG + Intronic
963966890 3:151381779-151381801 CTCCCTAAGGCTGGCTTAAGGGG - Intronic
967860237 3:194145707-194145729 CTCCCCCTCGGTCTCTTCAGTGG - Intergenic
968565930 4:1312824-1312846 CACTTTCTGGGTGTCTTCAGTGG - Intronic
971493565 4:27240008-27240030 CACGCTAGGGGTGTCTTGAGGGG - Intergenic
974700638 4:65440828-65440850 CTCCCTATGGGTGTCTTCAGAGG + Intronic
977100953 4:92814549-92814571 CTCCCTATGGGTGACTTATTTGG - Intronic
977691652 4:99918622-99918644 CTCCCCTTGAGTGTCTTCAGAGG - Intronic
978310653 4:107381958-107381980 GTCCCAATGGGGGTCTTGAGTGG - Intergenic
980522753 4:133953550-133953572 CTCCCTCTGAGTTTCTGCAGAGG - Intergenic
985526313 5:404357-404379 TTCATTCTGGGTGTCTTCAGTGG + Intronic
986566868 5:9124189-9124211 CTCCCCTTGAGTGCCTTCAGAGG - Intronic
996599370 5:125244067-125244089 CTCATTATTGGTCTCTTCAGGGG + Intergenic
997644061 5:135468594-135468616 CTCCATATGGGGTTCTGCAGAGG + Intergenic
998963955 5:147517748-147517770 TTGTCTAAGGGTGTCTTCAGGGG - Intergenic
1000646770 5:163769124-163769146 CTCCCTATGTGAGTTTCCAGAGG - Intergenic
1001200805 5:169714506-169714528 CTCCATGTGGGTGGCTTCAGGGG + Intronic
1003606061 6:7562085-7562107 CTCCCTATGGGCCACTTCAAAGG - Intronic
1007647320 6:43392927-43392949 CTCCCTCTGCGTTTCTGCAGAGG + Intergenic
1014011773 6:116484356-116484378 CTTTCTATGGCTTTCTTCAGTGG + Intergenic
1016803032 6:148185501-148185523 CTCCCTGTCGGTGGCTGCAGGGG + Intergenic
1016896666 6:149060443-149060465 CTCCCTAGGGCTGCCTCCAGCGG - Intronic
1017281399 6:152629734-152629756 CTCCCTGTGGGCCTCTTCGGAGG - Intronic
1017573129 6:155769970-155769992 CTACCTATGTGTGTCTTTACAGG + Intergenic
1023094370 7:36645162-36645184 CTCCCTATGATGGTTTTCAGAGG + Intronic
1025756974 7:64352967-64352989 TTTCCTATGGGTATGTTCAGGGG + Exonic
1029528509 7:101109938-101109960 CTCCCTATGAGTTCCTTCATTGG - Intergenic
1030678229 7:112407115-112407137 CTTACTATGGGAGTCTTGAGTGG + Intergenic
1031110576 7:117603653-117603675 CTTGCTATGGGATTCTTCAGAGG + Exonic
1031120473 7:117716041-117716063 CTCCAAATAAGTGTCTTCAGTGG + Intronic
1031998020 7:128245695-128245717 CTCCCCATTGATGTCATCAGAGG + Intronic
1033970564 7:147034375-147034397 CTCCCTATGGGTTTGAGCAGGGG - Intronic
1036628851 8:10496393-10496415 TTCCAAGTGGGTGTCTTCAGTGG - Intergenic
1036822372 8:11951182-11951204 CTCACTAAGGGTGTCCACAGGGG - Intergenic
1041848572 8:62360096-62360118 CTCCCTTTGGGTGGCTGCATGGG - Intronic
1042193116 8:66208286-66208308 GTCACTATGGGGGTCTTCTGAGG + Intergenic
1046449168 8:114365426-114365448 CAGCCTATGTGTGTCTTCATAGG - Intergenic
1046649204 8:116818479-116818501 TTCCCCATTGGAGTCTTCAGAGG - Intronic
1048512883 8:135078486-135078508 CTCCCTATGTGTGCCCTCAGGGG + Intergenic
1051423871 9:16915208-16915230 CTCACTTTGCGTGTCTTCTGAGG + Intergenic
1057172061 9:92968974-92968996 CTCACTGTGGGTGGCCTCAGTGG + Intronic
1059772453 9:117440415-117440437 CCCCATATGGGTCTCTTCATGGG - Intergenic
1062199002 9:135290928-135290950 CTCCCTCTGCGTTTCTGCAGAGG + Intergenic
1186799087 X:13075175-13075197 TTCCCCATGGGTGACTGCAGTGG - Intergenic
1187272080 X:17788506-17788528 CTCCCCAGGGGTGTCTCAAGAGG + Intergenic
1190275505 X:48896802-48896824 TTCACTATGGGTGTCATCGGTGG - Exonic
1191256468 X:58281666-58281688 CTGCTTTTGGGTGCCTTCAGTGG + Intergenic
1192576325 X:72245971-72245993 CTCCCTTTGGGTTACCTCAGTGG + Intronic
1193409879 X:81149672-81149694 CACGCTATGTGTGTCTTCATAGG - Intronic
1193848952 X:86511732-86511754 CTGCCTATGTGTGACTACAGGGG + Intronic
1195282281 X:103348072-103348094 CTCCCTTTTGGTGTCTGCATAGG - Intergenic
1201759732 Y:17523561-17523583 CTCCCTAAGGCTGCTTTCAGCGG + Intergenic
1201841822 Y:18382429-18382451 CTCCCTAAGGCTGCTTTCAGCGG - Intergenic