ID: 974702562

View in Genome Browser
Species Human (GRCh38)
Location 4:65470919-65470941
Sequence CAAAATTCAGATATTGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 2, 2: 4, 3: 44, 4: 757}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974702562_974702567 28 Left 974702562 4:65470919-65470941 CCTATAACAATATCTGAATTTTG 0: 1
1: 2
2: 4
3: 44
4: 757
Right 974702567 4:65470970-65470992 ATTCAAACTGTGTTCAAATAAGG 0: 16
1: 254
2: 323
3: 428
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974702562 Original CRISPR CAAAATTCAGATATTGTTAT AGG (reversed) Intronic
903369210 1:22824501-22824523 CAATATTCAGAAACTGGTATAGG + Intronic
904345969 1:29870004-29870026 CTAAATTCTGGTCTTGTTATAGG + Intergenic
905517547 1:38573099-38573121 CAGAATTCAAATATTTTCATGGG + Intergenic
907782976 1:57584073-57584095 CAAGACTCAGCTATTGTTACAGG - Intronic
907876388 1:58492740-58492762 CCAATTTCAGATCCTGTTATTGG - Intronic
908716207 1:67072481-67072503 CAAGACTCAGTTATTGTTACAGG + Intergenic
908732527 1:67240983-67241005 CAAGACTCAGCTATTGTTACGGG + Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909119987 1:71590298-71590320 TATAATTCAGATAGTGGTATTGG + Intronic
909185176 1:72478571-72478593 CAACACTCAGTTATTGTTACAGG - Intergenic
909211823 1:72833951-72833973 TCAAATTCAGAACTTGTTATTGG - Intergenic
909221054 1:72962338-72962360 TTAATTTCAGAAATTGTTATTGG - Intergenic
909232046 1:73103669-73103691 CCAATTTCAGATCTTGTTACTGG - Intergenic
909548532 1:76873453-76873475 TAAATTTTAGATATTGTTGTAGG - Intronic
909576226 1:77179442-77179464 CAAGACTCAGCTATTGTTACAGG - Intronic
909585914 1:77287877-77287899 CAAGACTCAGCTATTGTTACAGG + Intronic
909874654 1:80786982-80787004 TCAAATTCAGAACTTGTTATTGG - Intergenic
909875513 1:80797817-80797839 CAAAATCCAGATATTGTCAATGG - Intergenic
909954193 1:81757430-81757452 CAAGACTCAGTTATTGTTACAGG - Intronic
911214912 1:95182140-95182162 GAAAGTTCAGATTTTGTTGTTGG + Intronic
911464654 1:98236374-98236396 TCAACTTCAGATCTTGTTATTGG - Intergenic
911609089 1:99940910-99940932 CAAAATTTAGATTTTGATTTTGG + Intergenic
912231764 1:107801540-107801562 CAACACTCAGCTATTGTTACAGG - Intronic
913931000 1:124964507-124964529 ACAATTTCAGATCTTGTTATTGG + Intergenic
914880364 1:151541703-151541725 TAAAATACAGATGTTGCTATTGG + Intronic
916545506 1:165800491-165800513 CAAGACTCAGCTATTGTTACAGG - Intronic
916897979 1:169186431-169186453 TAAATTTCAGAACTTGTTATTGG + Intronic
916973775 1:170052310-170052332 TAAATTTCAGAACTTGTTATTGG - Intronic
917256200 1:173119215-173119237 CACAATTCAGCTATTATTACTGG + Intergenic
917681231 1:177370032-177370054 TCAAATTCAGAGCTTGTTATTGG + Intergenic
918032969 1:180834578-180834600 AAAAATCCAAATATTGTTAAGGG - Intronic
918171420 1:182001379-182001401 CAAATTTCAGGAATAGTTATGGG + Intergenic
918464809 1:184810560-184810582 CAACACTCAGTTATTGTTACAGG - Intronic
918465517 1:184817839-184817861 CAAAACTCAACTATTGTTATAGG - Intronic
918814455 1:189164945-189164967 CTAATTTCAGAACTTGTTATTGG + Intergenic
919085574 1:192917088-192917110 CAAAACTCAGTGATTGGTATAGG + Intergenic
919160052 1:193817343-193817365 CAAGACTTAGATATTGTTACAGG + Intergenic
919164796 1:193878446-193878468 TAAATTTCAGAATTTGTTATTGG + Intergenic
919411000 1:197242840-197242862 TCAATTTCAGAAATTGTTATTGG + Intergenic
919544291 1:198894617-198894639 CAAAATTCAGATATTAAACTTGG - Intergenic
919585365 1:199431911-199431933 CAAGACTCAGCTATTGTTACAGG + Intergenic
919599303 1:199602989-199603011 CCAATTTCAGAACTTGTTATTGG - Intergenic
919602216 1:199636312-199636334 TCAATTTCAGAAATTGTTATTGG - Intergenic
919612267 1:199760026-199760048 CAACACTCAGCTATTGTTACAGG - Intergenic
920058131 1:203207520-203207542 CAACACTCAGCTATTGTTACAGG + Intergenic
920242087 1:204560297-204560319 CAAGACTCAGCTATTGTTACAGG + Intergenic
920993591 1:210964576-210964598 CCAATTTCAGATCTGGTTATTGG - Intronic
921122228 1:212147160-212147182 CAAAATTAAAACATTTTTATTGG - Intergenic
921503390 1:215935165-215935187 AAAAATTCAGGGATTTTTATTGG - Intronic
921532622 1:216304170-216304192 CTAAATTCAGATATTATTAGCGG - Intronic
921925646 1:220708147-220708169 CAAAATTCAGGTGTTGCTAATGG - Intergenic
922255331 1:223888667-223888689 AAAAAATCAGATATTTTCATGGG - Intergenic
922321389 1:224491019-224491041 CAAGACTCAGCTATTGTTACAGG + Intronic
923955209 1:239009926-239009948 CAAAAGTCAAATATTCTTTTGGG - Intergenic
924849808 1:247815658-247815680 CAAAATGCACATATTTTTATTGG + Exonic
1063571938 10:7223311-7223333 CAAAATCCAGCCATTGTAATAGG + Intronic
1063908737 10:10807549-10807571 CAGAATTCAGAATTTGTTCTTGG - Intergenic
1064302535 10:14135286-14135308 CAAGACTCAGCTATTGTTACAGG - Intronic
1064642941 10:17432798-17432820 CAAAACTCAGCTATTGTTATAGG - Intronic
1064726795 10:18288233-18288255 CAATGTTCTGATGTTGTTATGGG - Intronic
1065040832 10:21694338-21694360 CTAAATTCAGATTATGTTTTGGG + Intronic
1065608759 10:27449052-27449074 TAAAATGCATATAATGTTATGGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066479123 10:35778421-35778443 CAAAATCCAGTTATTTTTCTAGG - Intergenic
1066613369 10:37273678-37273700 TCAATTTCAGAAATTGTTATTGG + Intronic
1067198947 10:44149072-44149094 TAAATTTCAGATCCTGTTATTGG + Intergenic
1067383560 10:45797361-45797383 TAAAATAAAGAAATTGTTATGGG + Intergenic
1067676745 10:48386979-48387001 CAAAATGTAGAAATTGTTAAGGG + Intronic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1067880618 10:50041439-50041461 TAAAATAAAGAAATTGTTATGGG - Intergenic
1068015412 10:51510185-51510207 CAAAATTAAAATAATATTATTGG - Intronic
1068116840 10:52745404-52745426 CAAGACTCAGCTATTGTTACAGG - Intergenic
1068200528 10:53778342-53778364 CAAAATTCCTATCCTGTTATTGG + Intergenic
1068526562 10:58137340-58137362 CAAGACTCAGCTATTGTTACAGG - Intergenic
1068636516 10:59354172-59354194 CAAAGTTCAGGTATTATTTTGGG - Intronic
1068755832 10:60652005-60652027 AAAAATTCTGTTATTTTTATAGG - Intronic
1068782149 10:60931652-60931674 CAAAAATCATGTATTATTATTGG - Intronic
1069176328 10:65293380-65293402 CAACATTCAGCTATTGTTACAGG - Intergenic
1070250514 10:74769012-74769034 CAAGATTCAGCGATTGTTACAGG + Intergenic
1070710543 10:78679162-78679184 TAAATTTCAGAGCTTGTTATTGG + Intergenic
1071077264 10:81769881-81769903 ACAATTTCAGATCTTGTTATTGG + Intergenic
1071363573 10:84876336-84876358 CAAAATTCAGTGATTGGTACAGG + Intergenic
1071593234 10:86896317-86896339 CAAACTTAAGAAAATGTTATTGG - Intronic
1072147016 10:92650668-92650690 CAAAAATCTGATATTGATAAGGG + Intronic
1072356983 10:94621469-94621491 CCAATTTCAGAATTTGTTATTGG - Intergenic
1072724728 10:97805389-97805411 CAAAATTCAGCAACTGTTCTAGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073285920 10:102388186-102388208 GAAAATTCACATATTTTTCTTGG - Intergenic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1073711452 10:106047482-106047504 GAAAACTCAAATATTTTTATAGG - Intergenic
1073995505 10:109311426-109311448 CAAATTTTAGATATTCTAATGGG - Intergenic
1073997239 10:109329680-109329702 TTAAATTCAGGTATTTTTATAGG - Intergenic
1074282459 10:112065727-112065749 AAAATTTCAGCTACTGTTATTGG - Intergenic
1075019923 10:118944290-118944312 CAAAAGCCAGACATTCTTATAGG - Intergenic
1076419537 10:130320942-130320964 AAACATTCAGAAGTTGTTATAGG + Intergenic
1078833120 11:14995638-14995660 TCAATTTCAGATTTTGTTATGGG - Intronic
1079850304 11:25525003-25525025 CTAAATTCAAATAATGATATTGG - Intergenic
1079892051 11:26067975-26067997 CAAGACTCAGTTATTGTTACAGG + Intergenic
1079971018 11:27035284-27035306 TCAATTTCAGAGATTGTTATTGG - Intergenic
1080409806 11:32012742-32012764 CTATATCCAGATATTCTTATGGG - Intronic
1080478472 11:32620774-32620796 CAAAGTTTAAATATTGTTGTAGG - Intronic
1080730945 11:34952164-34952186 ACAATTTCAGATACTGTTATTGG - Intronic
1080965312 11:37207744-37207766 TCAATTTCAGAAATTGTTATTGG + Intergenic
1082972725 11:59040753-59040775 CAGCATTCAAATATTGTTACAGG - Intronic
1082977180 11:59084654-59084676 CAACATTCAAGTATTGTTACAGG - Intergenic
1085785924 11:79449098-79449120 CAAGACTCAGCTATTGCTATAGG - Intergenic
1085884734 11:80508562-80508584 TCAATTTCAGATCTTGTTATTGG - Intergenic
1086805337 11:91234519-91234541 CAAAAAACAAATATTCTTATAGG + Intergenic
1087428096 11:98015840-98015862 TCAATTTCAGAAATTGTTATTGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088060659 11:105645294-105645316 CAAAATTCAGATATGCTCCTTGG + Intronic
1088103935 11:106184903-106184925 CAACACTCAGCTATTATTATGGG - Intergenic
1088104491 11:106190775-106190797 CCACACTCAGCTATTGTTATGGG - Intergenic
1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG + Intronic
1088161393 11:106875742-106875764 CAAAATTCATGTATTGCAATAGG + Intronic
1088327940 11:108620264-108620286 CAACACTCAGCTATTGTTACAGG - Intergenic
1088331224 11:108654457-108654479 CAAGACTCAGCTATTGTTACAGG + Intergenic
1089240500 11:117074347-117074369 CAAAATACATATACTGTTGTGGG - Intronic
1090028856 11:123190418-123190440 AAAAATTCAGAGAATGTTACTGG + Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090632137 11:128658576-128658598 CAAGACTCAGCTATTGTTACAGG - Intergenic
1092562941 12:9635741-9635763 CAAAATTAAGATTTTATTCTTGG + Intergenic
1093128821 12:15364717-15364739 CAAAATTCAGAGAAAGTTTTGGG - Intronic
1093135811 12:15449270-15449292 CAAGACTCAGTTATTGTTACAGG + Intronic
1093222976 12:16446197-16446219 GAATATCCAGATATTGCTATTGG - Intronic
1093402592 12:18764326-18764348 TCAATTTCAGAAATTGTTATTGG - Intergenic
1093595880 12:20958802-20958824 TCAAATTCAGAACTTGTTATTGG - Intergenic
1094139719 12:27168495-27168517 TAAATTTCAGAACTTGTTATTGG + Intergenic
1094785221 12:33840964-33840986 CCTAATTCTGATAATGTTATTGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095407761 12:41886776-41886798 CAAATTTTAGAGATTCTTATAGG - Intergenic
1095538876 12:43285152-43285174 CAAAATTTTTATATTGTTCTGGG + Intergenic
1096020711 12:48322713-48322735 CAAATTTCAGCTCCTGTTATTGG + Intergenic
1097330180 12:58324430-58324452 CAAGACTCAGGTATTGTTACAGG - Intergenic
1097885989 12:64729855-64729877 TAATATTCAGATATTTTTATAGG - Intronic
1097964943 12:65569005-65569027 CAAAAGTTACATATTTTTATGGG - Intergenic
1097986633 12:65789297-65789319 CAAGACTCAGCTATTGTTACAGG - Intergenic
1098054377 12:66488945-66488967 TAAATTTCAGAACTTGTTATTGG - Intronic
1098094055 12:66935857-66935879 CAACACTCAGTTATTGTTAAAGG + Intergenic
1098110472 12:67116559-67116581 AAAAATTCAGATAATGAAATAGG - Intergenic
1098499047 12:71169089-71169111 CAAGACTCAGTTATTGTTATAGG + Intronic
1098502112 12:71205340-71205362 CAAAACTCAGCTATTGTTACAGG - Intronic
1098502663 12:71211665-71211687 CAAGACTCAGCTATTGTTACAGG - Intronic
1098747752 12:74261929-74261951 CAAAATTCAGATTGTGTCCTGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099554498 12:84094109-84094131 CATAATACAAATAATGTTATAGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099690524 12:85946181-85946203 CAACACTCAGCTATTGTTACAGG + Intergenic
1099699457 12:86065035-86065057 CCAATTTCAGAACTTGTTATTGG - Intronic
1100221918 12:92514388-92514410 CATAATGCAGATTTTGTAATAGG - Intergenic
1100578826 12:95919381-95919403 CAAGATTCAGCTATTGTTACAGG + Intronic
1100760752 12:97804347-97804369 CAAGACTCAGCTATTGTTATAGG + Intergenic
1100860884 12:98805629-98805651 CAAAATACAGAGATTTTTACTGG + Intronic
1100890273 12:99117864-99117886 TCAATTTCAGAAATTGTTATTGG + Intronic
1100916171 12:99424851-99424873 CAAGACTCAGCTATTGTTACAGG - Intronic
1101058744 12:100948632-100948654 CAAAATTAAGATATTGTAGATGG + Intronic
1101216164 12:102586160-102586182 AAAAATACAGATTTGGTTATTGG - Intergenic
1101315173 12:103622491-103622513 CAAAACTCAGCTATTGTTACAGG + Intronic
1101545999 12:105713424-105713446 CAACACTCAGCTATTGTTAAAGG - Intergenic
1101579386 12:106028126-106028148 AAAAATTCAGATCTTGATCTTGG - Intergenic
1102323813 12:111961148-111961170 TAAATTTCAGAACTTGTTATTGG - Intronic
1102667186 12:114585018-114585040 TAAAAGTCAGATGTTGTTTTTGG - Intergenic
1103287560 12:119815404-119815426 CCAAATTCAGTAATTTTTATTGG - Intronic
1103593374 12:122008012-122008034 CAAAACTCAGAAATTAATATTGG - Intergenic
1105340448 13:19518569-19518591 CAAATTTTAGATATTCTAATAGG - Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105630220 13:22156440-22156462 CAAAATTTATATTTTGTTCTTGG + Intergenic
1105798655 13:23883115-23883137 AAAAATTCAGATAATCTTACTGG + Intronic
1105961419 13:25344612-25344634 AAAAATTCTGAGATTTTTATTGG + Intronic
1107289503 13:38836611-38836633 CCAATTTCAGAACTTGTTATTGG + Intronic
1107635549 13:42388741-42388763 CACAATTCAGCTCATGTTATTGG + Intergenic
1107824384 13:44314489-44314511 CAAGACTCAGCTATTGTTACAGG + Intergenic
1108390117 13:49938589-49938611 CAAGACTCAGCTATTGTTACAGG + Intergenic
1108810117 13:54212165-54212187 CAAGACTCAGCTATTGTTACAGG + Intergenic
1109035506 13:57254669-57254691 GAAAAGACAGATATTATTATGGG + Intergenic
1109605684 13:64692436-64692458 CAAAATTCAGAGATTAACATTGG + Intergenic
1109609231 13:64741356-64741378 CAAAACTCAGGTATTGTTACAGG + Intergenic
1110050302 13:70888376-70888398 CAACACTCAGCCATTGTTATAGG - Intergenic
1110557592 13:76877834-76877856 CAAAGTTCAAATCTTGTAATGGG + Intergenic
1110734714 13:78922825-78922847 CAAGACTCAGCTATTGTTACAGG + Intergenic
1110855541 13:80293188-80293210 ATAAATTCAGGTATGGTTATTGG + Intergenic
1110941346 13:81353910-81353932 CAACACTCAGCTATTGTTATGGG - Intergenic
1111308201 13:86445001-86445023 GAAAATTGAGATATTATTAATGG + Intergenic
1111429630 13:88134703-88134725 CAAGACTCAGCTATTGTTATAGG + Intergenic
1111647088 13:91044911-91044933 CAAAATTCAGATAATTTTCCCGG - Intergenic
1111923053 13:94432544-94432566 CAACACTCAGCTATTGTTACAGG - Intergenic
1112595140 13:100801051-100801073 CAAGACTCAGCTATTGTTACAGG + Intergenic
1112764112 13:102722561-102722583 CAAAATTCAGAAAGTTTTACAGG - Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113236807 13:108285110-108285132 CAATTTTCAGATATTTTGATAGG - Intronic
1113291701 13:108913804-108913826 CAAGACTCAGCTATTGTTACAGG - Intronic
1113336818 13:109384489-109384511 CAACACTCAGCTATTGTTACAGG - Intergenic
1114198727 14:20503672-20503694 CAAAATCCAGATATTCTTATGGG + Intergenic
1114334611 14:21675394-21675416 CAAAACTCAGCTACTGTTACAGG - Intergenic
1114335221 14:21682302-21682324 CAAGACTCAGCTATTGTTACAGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114971385 14:28033680-28033702 TAAATTTCAGAACTTGTTATTGG + Intergenic
1115012168 14:28562123-28562145 AATAATTCTGATATTGCTATAGG + Intergenic
1115719544 14:36145327-36145349 CCAATTTCAGATCCTGTTATTGG + Intergenic
1115908362 14:38227053-38227075 CAAGACTCAGTTATTGTTACAGG - Intergenic
1116077970 14:40136220-40136242 TCAATTTCAGATCTTGTTATTGG + Intergenic
1116365560 14:44058437-44058459 CAAAGTTCAGATATTGTTATAGG - Intergenic
1116428984 14:44823925-44823947 GCAAATTCAGAACTTGTTATTGG - Intergenic
1116775969 14:49181149-49181171 TAAATTTCAGAACTTGTTATTGG - Intergenic
1117223352 14:53630202-53630224 AAATATTTAAATATTGTTATTGG + Intergenic
1117410934 14:55450447-55450469 CAAGACTCAGCTATTGTTACAGG + Intronic
1118418391 14:65570865-65570887 CAAGACTCAGCTATTGTTACAGG - Intronic
1118635805 14:67747878-67747900 CAAAATTCAGAGATGGCTTTGGG - Exonic
1119184289 14:72628484-72628506 CAAAATAGTGATATTCTTATTGG - Intronic
1119463643 14:74834429-74834451 TAAAATTCAGTTATTGATCTAGG + Intronic
1119633470 14:76254624-76254646 CAAGACTCAGCTATTGTTACAGG + Intergenic
1120019171 14:79508690-79508712 AAAAAATCAGTTATTGTTTTAGG - Intronic
1120584547 14:86295930-86295952 CAAAAGTCTCATGTTGTTATTGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120711347 14:87796478-87796500 CAAGACTCAGCTATTGTTACAGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124108440 15:26763249-26763271 CAAAACTCAGATATTTTTTCTGG + Intronic
1124151642 15:27184495-27184517 GAAAATATAGATATAGTTATTGG + Intronic
1125073511 15:35584827-35584849 CAATTTTCAGTTATTGTTTTGGG - Intergenic
1125232647 15:37474498-37474520 CCAATTTCAGATCCTGTTATTGG - Intergenic
1125931981 15:43606736-43606758 CAACATTCTTATATTTTTATAGG - Intronic
1125945080 15:43706211-43706233 CAACATTCTTATATTTTTATAGG - Intergenic
1126234344 15:46365315-46365337 CAAAACCCAGATAATGATATTGG - Intergenic
1126374589 15:47983896-47983918 CAAGACTCAGTTATTGTTACCGG + Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126619786 15:50626372-50626394 GAAAATTAAGATTTTGTTCTAGG - Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127400296 15:58578869-58578891 CAAAAATCAAATATTCTAATTGG + Intergenic
1127525516 15:59789011-59789033 CATAATTCACAAATTATTATAGG - Intergenic
1128824910 15:70705058-70705080 CAAGACTCAGCTATTGTTACGGG + Intronic
1130193408 15:81757481-81757503 CAACACTCAGCTATTGTTATGGG - Intergenic
1131328554 15:91472844-91472866 AAAAATTCAGACATTTTAATAGG + Intergenic
1131659689 15:94500179-94500201 ATAAATTCACATATTGTGATTGG + Intergenic
1133560214 16:6943735-6943757 CAAGACTCAGCTATTGTTACAGG - Intronic
1133816597 16:9202405-9202427 CAAGACTCAGCTATTGTTACAGG - Intergenic
1134518953 16:14909389-14909411 CAAGACTCAGCTATTGTTACAGG + Intronic
1134706624 16:16308044-16308066 CAAGACTCAGCTATTGTTACAGG + Intergenic
1134960916 16:18404080-18404102 CAAGACTCAGCTATTGTTACAGG - Intergenic
1134965218 16:18486683-18486705 CAAGACTCAGCTATTGTTACAGG - Intronic
1136528219 16:30847100-30847122 CACAAGTCAGAGATTGTTTTAGG - Intronic
1137065170 16:35833067-35833089 TCAATTTCAGAAATTGTTATTGG + Intergenic
1138242967 16:55443972-55443994 ATATATTCAGATATTGTTTTTGG + Intronic
1138837515 16:60456692-60456714 CTCAATTCAGAATTTGTTATTGG + Intergenic
1138887223 16:61094170-61094192 TCAATTTCAGAAATTGTTATTGG - Intergenic
1139080124 16:63507392-63507414 CATAATTCATATATTGGTTTGGG - Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140645476 16:77025052-77025074 CAAGACTTAGCTATTGTTATAGG + Intergenic
1140876306 16:79155664-79155686 CAAAGTGCAGATTTGGTTATAGG + Intronic
1142551103 17:740269-740291 CAAAATTCAGAGCTTGGTGTGGG + Intronic
1144158078 17:12527609-12527631 CAAAATTCATAGATGTTTATGGG + Intergenic
1144893392 17:18509160-18509182 CAAAATTCAGATAAAGTTGAAGG + Intergenic
1145138834 17:20435114-20435136 CAAAATTCAGATAAAGTTGAAGG - Intergenic
1146448582 17:32953376-32953398 CAAGACTCAGCTATTGTTACAGG + Intergenic
1146547745 17:33753766-33753788 CAAGACTCAGCTATTGTTACAGG + Intronic
1148260043 17:46174081-46174103 AAAAATTCAGATTTTATTATTGG - Intronic
1148319076 17:46734100-46734122 CTTACTTCAGATATGGTTATAGG + Intronic
1149051201 17:52307454-52307476 CAAAACCCAGAAATTGTAATAGG + Intergenic
1150881799 17:69038042-69038064 CTCAATTCAGAACTTGTTATTGG - Intronic
1150933901 17:69614611-69614633 AAAATTTCAGATCCTGTTATTGG + Intergenic
1153122424 18:1745317-1745339 CAAAATTCTCTTATTGTCATTGG + Intergenic
1153158047 18:2171403-2171425 CAAATTTCAGAAATAATTATGGG + Intergenic
1155128807 18:22909068-22909090 CAATCTTCAGATATAATTATGGG + Intronic
1155718745 18:28982797-28982819 CCAAATCCAGATATTTTTCTGGG - Intergenic
1155768127 18:29662573-29662595 CACATTTCAGATATTATTCTAGG + Intergenic
1155848104 18:30734420-30734442 TCAAATTCAGAGATTGTTACAGG - Intergenic
1156188070 18:34686813-34686835 TCAAATTCAGAATTTGTTATTGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156626574 18:38916956-38916978 ACAAATTCAGAACTTGTTATTGG + Intergenic
1156739773 18:40310286-40310308 CGTGATTCAGATATTTTTATTGG - Intergenic
1156896471 18:42252401-42252423 CTCAATTCAGAGCTTGTTATTGG + Intergenic
1157194549 18:45610198-45610220 CAAAATACAGATTCTGTTATGGG + Intronic
1157481380 18:48056332-48056354 AGAAATTCCGATATTTTTATTGG - Intronic
1157673818 18:49553207-49553229 CAAGACTCAGCTATTGTTATAGG + Intergenic
1157787418 18:50496832-50496854 AAATGTTCAGATATTGTTGTTGG - Intergenic
1158007407 18:52688316-52688338 TAAAATTAAAATATTGCTATTGG - Intronic
1158767180 18:60466209-60466231 CAAGATTCAGATAATTTTGTAGG - Intergenic
1159239576 18:65724517-65724539 CTAAATTTAGATAGTGTGATGGG + Intergenic
1159280012 18:66273204-66273226 CAAGACTCAGCTATTGTTACAGG - Intergenic
1159645484 18:70913441-70913463 TCAATTTCAGATCTTGTTATTGG + Intergenic
1160604128 18:80036314-80036336 AAGGATTCAGATACTGTTATAGG - Intronic
1163931423 19:20396874-20396896 AAAAATTGAGAACTTGTTATAGG + Intergenic
1164264982 19:23606954-23606976 CCAATTTCAGAATTTGTTATTGG + Intronic
1165918272 19:39274988-39275010 CAACCCTCAGCTATTGTTATGGG + Intergenic
1166632931 19:44423535-44423557 TTAATTTCAGAAATTGTTATTGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925484192 2:4310032-4310054 CCAATTTCAGAACTTGTTATTGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925822378 2:7812993-7813015 CAACACTCAGCTATTGTTACAGG + Intergenic
925960414 2:9009278-9009300 CAAACTGCATATTTTGTTATGGG + Intergenic
926507964 2:13739525-13739547 CAAGAATCAGATATTGTACTAGG + Intergenic
927129141 2:20042650-20042672 GAAAATTCAGATATTATAATGGG - Intronic
927140507 2:20127171-20127193 CAAAATTCTGATGGTGTTAATGG + Intergenic
927647885 2:24890073-24890095 CAAAATTGAGATGATCTTATGGG + Intronic
927950303 2:27163536-27163558 CAAGACTCAGCTATTGTTACAGG - Intergenic
928241002 2:29586558-29586580 CAATATTAATATATTGTCATGGG - Intronic
928386750 2:30875836-30875858 CCAATTTCAGAACTTGTTATTGG - Intergenic
928854509 2:35788499-35788521 CAAAATTAAGATAACTTTATTGG - Intergenic
928992292 2:37246386-37246408 CACAATTCAGATCCTGTTAAAGG - Intronic
929274547 2:40011267-40011289 CCAATTTCAGATCCTGTTATTGG + Intergenic
930409583 2:51007358-51007380 AATAATTCAGAAATTGTCATAGG - Intronic
930498074 2:52174475-52174497 CAAGACTCAGCTATTGTTACAGG - Intergenic
930910466 2:56623298-56623320 CAAAATTAAGATATTTTCTTAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931444908 2:62318490-62318512 CAACACTCAGTTATTGTTACAGG + Intergenic
931621534 2:64215539-64215561 CAAAATGCAGAGACTGCTATTGG + Intergenic
932289509 2:70564596-70564618 CAAATTGCACATATTATTATAGG + Intergenic
933237403 2:79880484-79880506 TCAAATTCAGAACTTGTTATTGG + Intronic
933366076 2:81355828-81355850 CAGGGTTCAGATATTGTAATGGG + Intergenic
936868445 2:117105259-117105281 TCAATTTCAGAGATTGTTATTGG + Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937622026 2:123999563-123999585 CAAGACTCAGCTATTGTTACAGG + Intergenic
938922906 2:136011577-136011599 AAAAATTCAGTCATTGTTTTTGG + Intergenic
939037856 2:137154338-137154360 CAAAATTCAGAAAGTGTTTGAGG - Intronic
939325988 2:140689228-140689250 CAAGACTCAGCTATTGTTATAGG - Intronic
939434642 2:142159211-142159233 CAACATTTAGATATTTTTGTGGG - Intergenic
940176373 2:150881677-150881699 CAACACTCAGCTATTGTTACAGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940964830 2:159825432-159825454 TAAATTTCAGAACTTGTTATTGG - Intronic
941088233 2:161143980-161144002 CCAATTTCAGAACTTGTTATTGG + Intronic
941576941 2:167244636-167244658 CAAACTAGAGATATTGTTAAAGG + Exonic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941623671 2:167806981-167807003 CTCAATTCAGATCCTGTTATTGG + Intergenic
943106330 2:183548458-183548480 TCAATTTCAGATCTTGTTATTGG - Intergenic
943353157 2:186819172-186819194 TAAAATTAAAATGTTGTTATTGG - Intergenic
943575951 2:189631255-189631277 CAAAAGTAAAATCTTGTTATTGG + Intergenic
943629982 2:190240166-190240188 TCAATTTCAGAAATTGTTATTGG + Intronic
943775872 2:191765187-191765209 ACAATTTCAGATCTTGTTATTGG - Intergenic
943837154 2:192527970-192527992 TGAAATTCAGAATTTGTTATTGG - Intergenic
943869308 2:192973844-192973866 CAACACTCAGCTATTGTTACAGG - Intergenic
943969049 2:194379724-194379746 CAAGACTCAGCTATTGTTACAGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945802870 2:214455194-214455216 TGAAATTCAGATAGTGTCATAGG - Intronic
946566165 2:220967919-220967941 CAAGACTCAGCTATTGTTACAGG + Intergenic
946616032 2:221511337-221511359 CAAGACTCAGCCATTGTTATAGG - Intronic
946888400 2:224247564-224247586 CAAGACTCAGCTATTGTTACAGG + Intergenic
946914019 2:224497016-224497038 CAAAATTAGAATATTTTTATGGG + Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947519399 2:230832387-230832409 CAAGACTCAGCTATTGTTACAGG - Intergenic
948076284 2:235167564-235167586 CAGAGTTCAGTGATTGTTATGGG + Intergenic
948078455 2:235185756-235185778 CAATACTCAGCTATTGTTACAGG + Intergenic
1169960026 20:11149456-11149478 TCAATTTCAGATCTTGTTATTGG + Intergenic
1170322635 20:15117332-15117354 CATAATTGAGATTTTGTTTTGGG + Intronic
1170826950 20:19804906-19804928 AAAATTTCAGAACTTGTTATTGG + Intergenic
1171079790 20:22167536-22167558 CAAAATTCAGATATAATTAAGGG + Intergenic
1171800112 20:29604528-29604550 CAACACTCAGCTATTGTTACAGG + Intergenic
1171808968 20:29724647-29724669 ACAATTTCAGATCTTGTTATTGG - Intergenic
1171835782 20:30143502-30143524 ACAATTTCAGATCTTGTTATTGG + Intergenic
1171843979 20:30252150-30252172 CAACACTCAGCTATTGTTACAGG - Intergenic
1172382794 20:34510728-34510750 TAAAATTCAGGTATTGTACTCGG + Exonic
1172547528 20:35772952-35772974 CAAAATTTGGACATTGTTTTCGG - Intronic
1173293272 20:41733217-41733239 CAAGACTCAGTTATTGTTACAGG - Intergenic
1174896506 20:54454943-54454965 CAACACTCAGCTATTGTTACAGG + Intergenic
1175053053 20:56172641-56172663 CAAGACTCAGCTATTGTTACAGG - Intergenic
1175339124 20:58216565-58216587 CAAAACTGAGATCTTGTTCTTGG - Intergenic
1175504950 20:59475582-59475604 CAAGACTCAGTTATTGTTACAGG + Intergenic
1175580126 20:60092157-60092179 CAGAATTCAGAAAATGTTGTAGG + Intergenic
1176136600 20:63525204-63525226 CAGAATTCAGAAACTGTTAGTGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176954272 21:15082601-15082623 CAAAATTCAAATACATTTATTGG - Intergenic
1177241533 21:18464734-18464756 TCAATTTCAGAAATTGTTATTGG - Intronic
1177313526 21:19427634-19427656 TCAAATTCAGAACTTGTTATTGG - Intergenic
1177511040 21:22088675-22088697 TCAATTTCAGATCTTGTTATTGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177738446 21:25122142-25122164 CAAGACTCAGCTATTGTTACAGG + Intergenic
1178009147 21:28262811-28262833 TAAGACTCAGCTATTGTTATAGG - Intergenic
1179013232 21:37572962-37572984 CAAGATTCAGCTATTGTTACAGG - Intergenic
1179222807 21:39424499-39424521 TAAATTTCAGCTATTGTCATGGG - Intronic
949107287 3:215678-215700 CACAATTCAAAAATTGTCATGGG + Intronic
949356665 3:3188201-3188223 CAAAACACAGATATTGATTTTGG - Intergenic
949586873 3:5449371-5449393 CAAGATTCAGCTATTTTTCTTGG + Intergenic
949590842 3:5492560-5492582 CAAAGGTCAGACATTGTTCTAGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951345351 3:21542164-21542186 GAAAATTCACATATTTTTAAAGG - Intronic
951548170 3:23850057-23850079 CAAAATTGACATATTCTCATTGG + Intronic
951551537 3:23879852-23879874 CATAGTTCAGATATTATTCTAGG - Intronic
951579914 3:24151681-24151703 CAAAATTCAGATAAGGTTTCTGG - Intronic
951628797 3:24696084-24696106 TCAATTTCAGATCTTGTTATTGG + Intergenic
952024006 3:29057116-29057138 CAACACTCAGCTATTGTTATGGG + Intergenic
952111268 3:30126249-30126271 TCAATTTCAGAAATTGTTATTGG + Intergenic
952474221 3:33689792-33689814 TAAAATTCAGATTTTGCTAATGG - Intronic
952578114 3:34799244-34799266 CAACACTCAGCTATTGTTATAGG - Intergenic
953141878 3:40236818-40236840 CAGAAATCAGGAATTGTTATTGG + Intronic
953228268 3:41040847-41040869 CAAAGTTCAAACACTGTTATTGG + Intergenic
953266116 3:41390039-41390061 TAAATTTCAGATCCTGTTATTGG + Intronic
955429718 3:58830056-58830078 CAGAAGTCAGATATTTTTCTGGG + Intronic
955576528 3:60370683-60370705 CAAACTTCAGATATAATTAAAGG - Intronic
955612228 3:60769757-60769779 CAACACTCAGCTATTGTTACAGG + Intronic
957452943 3:80402956-80402978 AAATATTGAGCTATTGTTATTGG + Intergenic
957603349 3:82367326-82367348 CAAGATTCAGCTATTGCTACAGG + Intergenic
957630703 3:82712671-82712693 CAACAATCAGCTATTGTTACAGG - Intergenic
958106082 3:89075411-89075433 TAAATTTCAGAACTTGTTATTGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958200585 3:90309741-90309763 ACAATTTCAGATACTGTTATTGG + Intergenic
958257142 3:91338083-91338105 CAATTTTCAGAACTTGTTATTGG + Intergenic
958647983 3:96897840-96897862 CCAAATTCATATATTCTGATAGG - Intronic
959101805 3:102018641-102018663 CAAGACTCAGTTATTGTTACAGG - Intergenic
959143443 3:102514551-102514573 TAAAATTCAGATATTCCAATTGG - Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959283813 3:104381321-104381343 GAAAATTCAGATATGTTTCTTGG - Intergenic
959881726 3:111451159-111451181 TAAATTTCAGAGCTTGTTATTGG - Intronic
960738471 3:120806061-120806083 CAAAATTCAGGAATTCCTATGGG - Intergenic
960746762 3:120898875-120898897 CCAATTTCAGATCCTGTTATTGG + Intergenic
961023991 3:123536139-123536161 TAAAATTTACATATTGATATAGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963237404 3:142969113-142969135 CTATATTCAGGTATTGTGATAGG + Intronic
964149740 3:153509740-153509762 CACATTTCAGATCCTGTTATTGG - Intergenic
964215766 3:154279702-154279724 CAAAGTGCAGACATTGTTCTTGG - Intronic
964287996 3:155141913-155141935 CAAGATTCAGTTATAGTTAGAGG - Intronic
964685810 3:159394982-159395004 ACAAATTCAGATCCTGTTATTGG + Intronic
965223884 3:165962328-165962350 ACAATTTCAGATCTTGTTATTGG - Intergenic
965278251 3:166715943-166715965 CAAAATTCAGTGATTGGCATGGG + Intergenic
965319707 3:167237836-167237858 CAAAATTCTTATATTGTAAAAGG + Intergenic
965496937 3:169410499-169410521 AAAAGTTGAGATATTGTCATAGG - Intronic
965703216 3:171479939-171479961 GAAATTTCAGATATGGTTATTGG + Intergenic
965945091 3:174231466-174231488 CAACACTCAGCTATTGTTACAGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966092459 3:176156813-176156835 CAAATTTCTCATTTTGTTATGGG + Intergenic
966251388 3:177869154-177869176 TCAATTTCAGAAATTGTTATTGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967178394 3:186882120-186882142 AACAATTCAGAAATTTTTATAGG + Intergenic
967443846 3:189541654-189541676 AAAAATTAAGATTATGTTATAGG + Intergenic
967599933 3:191374592-191374614 CAATATTCTGATAGTTTTATTGG + Intronic
967713974 3:192741882-192741904 CCAATTTCAGATCCTGTTATTGG + Intronic
967727720 3:192877455-192877477 AAAAATTCAGATATTGTTAAAGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970144831 4:13024513-13024535 CAAGACTCAGCTATTGTTACAGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970494620 4:16612677-16612699 TAAATTTCAGAGCTTGTTATTGG - Intronic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970699620 4:18720248-18720270 CAAGACTCAGCTATTGTTACAGG - Intergenic
970751248 4:19364661-19364683 CAAAATTCTGAAGTTTTTATGGG + Intergenic
970796876 4:19923372-19923394 CAAAACTTAGCTATTGTTACAGG + Intergenic
970829815 4:20323910-20323932 CAAATTTAAAATATTGTTTTAGG - Intronic
971600587 4:28586591-28586613 CAAGACTCAGCTATTGTTACAGG - Intergenic
971621754 4:28863450-28863472 GGAATTTCAGATAATGTTATTGG + Intergenic
972405369 4:38741380-38741402 CAAAATTTGGTTGTTGTTATAGG - Intergenic
972688703 4:41375527-41375549 AAAAAATCAGATACTGGTATTGG - Intronic
972989835 4:44811288-44811310 CAATTTTCAGAACTTGTTATTGG + Intergenic
973040492 4:45463364-45463386 CAAAGTTCACATATGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974180918 4:58383639-58383661 CCAATTTCAGAACTTGTTATTGG + Intergenic
974499559 4:62683297-62683319 TACAATTCAGATAATGTTATTGG + Intergenic
974524975 4:63039146-63039168 CAAAATTCAAATATTATTTAAGG + Intergenic
974541814 4:63247643-63247665 ACAATTTCAGATCTTGTTATTGG + Intergenic
974702562 4:65470919-65470941 CAAAATTCAGATATTGTTATAGG - Intronic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975019055 4:69465188-69465210 CAAGACTCAGTTATTGTTACAGG - Intergenic
975019610 4:69470104-69470126 CAAGACTCAGTTATTTTTATAGG - Intergenic
975133307 4:70849394-70849416 TAAGACTCAGCTATTGTTATAGG - Intergenic
975178233 4:71312245-71312267 CCAATTTCAGAACTTGTTATTGG - Intronic
975419316 4:74143765-74143787 CAATATTAAGATATTCTTCTAGG - Intronic
976081305 4:81358092-81358114 TAAAAGTCAGAAATGGTTATAGG + Intergenic
976302865 4:83531580-83531602 CAACACTCAGCTATTGTTACAGG - Intergenic
976491756 4:85678827-85678849 CAAAATGGACATTTTGTTATAGG + Intronic
976547313 4:86351234-86351256 TAAAATACAGATATTGTGGTAGG - Intronic
976787860 4:88842635-88842657 CAAAGTTAACAGATTGTTATTGG - Intronic
976902464 4:90196015-90196037 CAAAACCCAGATATTGTTCAGGG + Intronic
977038955 4:91990245-91990267 CTTAATTCAGATCTTGTTCTGGG + Intergenic
977058659 4:92227254-92227276 AAGATTTCAGACATTGTTATTGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977487845 4:97671399-97671421 CAAAATTTAAAAAATGTTATTGG - Intronic
977522668 4:98104986-98105008 CAAGACTCAGCTATTGTTACAGG - Intronic
977813057 4:101380749-101380771 TAAATTTCAGAACTTGTTATTGG + Intergenic
977869533 4:102074125-102074147 CAGATTTCAGAATTTGTTATTGG + Exonic
977919877 4:102631256-102631278 TAAAATTAAGATATTATTAGTGG - Intergenic
978090617 4:104710351-104710373 CTCAATTCAGAACTTGTTATTGG - Intergenic
978135853 4:105258449-105258471 CAAATTTCAGAGATTTTGATGGG + Intronic
978255132 4:106683954-106683976 CAAGACTCAGCTATTGTTACAGG - Intergenic
978709940 4:111767682-111767704 CCAATTTCAGAACTTGTTATTGG + Intergenic
978737570 4:112101320-112101342 TAAAATTCATATATTTTTGTGGG + Intergenic
978977425 4:114895459-114895481 CCAATTTCAGAGCTTGTTATTGG - Intronic
979141600 4:117183094-117183116 ACAATTTCAGATCTTGTTATTGG - Intergenic
979587923 4:122442990-122443012 TAAATTTCAGAACTTGTTATTGG + Intergenic
979857218 4:125649561-125649583 CAAACCTCAGTTATTGTTACAGG + Intergenic
980181644 4:129408284-129408306 CAAAATATAGATATTTTCATTGG + Intergenic
980524624 4:133973451-133973473 CTAGATTCAGCTATTTTTATTGG - Intergenic
980856581 4:138447719-138447741 CAAGACTCAGCTATTGTTACAGG - Intergenic
981101326 4:140832372-140832394 CAAGACTCAGCTATTGTTACAGG - Intergenic
981200813 4:141977644-141977666 CAACATTCAGCTATTGTTACAGG - Intergenic
981750179 4:148085953-148085975 CCAATTTCAGAACTTGTTATTGG - Intronic
981861789 4:149364225-149364247 TAAAAGTCACATATTGTTTTGGG + Intergenic
981967846 4:150628240-150628262 AAAAATTCAGACATTGAAATAGG - Intronic
982002899 4:151037443-151037465 CAACATCCAGATATTGTAAAGGG - Intergenic
982398966 4:154944845-154944867 CAAGACTCAGCTATTGTTACAGG + Intergenic
982659734 4:158192433-158192455 GAAATTTCAGTTATAGTTATAGG + Intergenic
982848559 4:160281050-160281072 TTAAATTCAGAACTTGTTATTGG - Intergenic
982955231 4:161756815-161756837 CAAAATACAGTTATTGTTGGTGG - Intronic
983340302 4:166452848-166452870 AAAAATTAAGACATTTTTATTGG - Intergenic
983456815 4:167975399-167975421 TCAATTTCAGAAATTGTTATGGG - Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983825732 4:172257167-172257189 CAAAATAAAGATATTGCTTTAGG - Intronic
984297302 4:177868588-177868610 TAAAGTTTAGTTATTGTTATGGG + Intronic
984361967 4:178745546-178745568 AAAATTTCATATATTATTATAGG + Intergenic
984747486 4:183236547-183236569 CAACACTCAGTTATTGTTACAGG + Intronic
984829276 4:183956204-183956226 TCAAATTCAGGTATTGTTAACGG - Intronic
984986234 4:185332532-185332554 GAAAATTCAGTAATTATTATCGG - Intronic
985193677 4:187405068-187405090 CTAAATTCAGAACTTATTATTGG + Intergenic
985268154 4:188169359-188169381 CAAACTTCAGATATTTTTCAAGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986225908 5:5812445-5812467 CAAGACTCAGCTATTGTTACAGG + Intergenic
986513332 5:8532779-8532801 TGATATTCAGATAATGTTATGGG - Intergenic
986540225 5:8837706-8837728 CAGAATACAGACATTTTTATTGG - Intergenic
986614007 5:9598309-9598331 GAAAATTTAGATAATGTTAAAGG + Intergenic
986879412 5:12152305-12152327 CCAACTTCAGAACTTGTTATTGG - Intergenic
986879890 5:12156969-12156991 CCAACTTCAGAACTTGTTATTGG - Intergenic
987541792 5:19264876-19264898 CAAGATTCCGGTATTGTTACAGG - Intergenic
987613628 5:20242797-20242819 GAATATTTAAATATTGTTATGGG - Intronic
987970047 5:24930784-24930806 AAAAGTTCAGATATTATTGTCGG - Intergenic
988190213 5:27920711-27920733 CTAAATTCAGATATTTTAATTGG - Intergenic
988224804 5:28399375-28399397 CAAGACTCAGCTATTGTTACAGG - Intergenic
988294298 5:29335063-29335085 TCAATTTCAGAAATTGTTATTGG - Intergenic
988836864 5:35041636-35041658 CAACATTAAGATAATTTTATAGG + Intronic
989723494 5:44558391-44558413 CCAAATCCAAATGTTGTTATGGG + Intergenic
990064958 5:51700950-51700972 TCAATTTCAGAAATTGTTATTGG + Intergenic
990080402 5:51905870-51905892 AAAATTTCAAATATTGATATTGG - Intergenic
990290428 5:54345260-54345282 CAAGACTCAGTTATTGTTACAGG - Intergenic
990290970 5:54351267-54351289 CAACACTCAGTTATTGTTACAGG - Intergenic
990307775 5:54510002-54510024 CAAAACTCAGCTGTTGTTACAGG + Intergenic
990432939 5:55754840-55754862 ACAATTTCAGATACTGTTATTGG + Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991240473 5:64452907-64452929 TAAAATTAAGATATAATTATTGG - Intergenic
991282921 5:64936766-64936788 TTAAATTCAGAACTTGTTATTGG + Intronic
991343179 5:65634506-65634528 CAAAAGTAAGATATTATTTTTGG - Intronic
992817393 5:80457601-80457623 TAAAATTAATATATTATTATAGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993116964 5:83730817-83730839 CAAAATTGGGTTATTGTTTTAGG + Intergenic
993280031 5:85913702-85913724 AAAATTTCAGAAATTGATATTGG - Intergenic
993392346 5:87335291-87335313 CAAAACTCAAATTTTGTCATTGG - Intronic
993745751 5:91594715-91594737 CAAGACTCAGCTATTGTTATAGG + Intergenic
993791033 5:92211466-92211488 CAATACTCAGCTATTGTTACAGG + Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994334646 5:98550010-98550032 ACAATTTCAGATACTGTTATTGG - Intergenic
994562448 5:101393730-101393752 CAAGACTCAGCTATTGTTACAGG - Intergenic
994661130 5:102655781-102655803 TAACATTCAGCTATTGTTACAGG + Intergenic
994707676 5:103225058-103225080 CAAGACTCAGCTATTGTTACAGG - Intergenic
994793637 5:104264889-104264911 TAAAAGTCAGATGTTGTTAGAGG - Intergenic
994854841 5:105105223-105105245 TAAAATTCAGATATGGCTGTGGG + Intergenic
994957980 5:106559734-106559756 CAAGATTCACATATTTTAATTGG - Intergenic
995327701 5:110909936-110909958 CAAAATCCGGAATTTGTTATTGG + Intergenic
995361041 5:111297733-111297755 CAACATTCAGATATTTGTATTGG - Intronic
995546595 5:113238562-113238584 CAAATTTAAGATTTTGTTATTGG + Intronic
995557035 5:113340448-113340470 CAAAATTAAAATATTTGTATTGG + Intronic
995591386 5:113703947-113703969 CAAAATGAAGATATTGAAATGGG - Intergenic
995626868 5:114089198-114089220 CAAAATTCAACTATTTTTAAAGG - Intergenic
996427593 5:123332023-123332045 CTCAATTCAGAACTTGTTATTGG + Intergenic
996848373 5:127926176-127926198 CAAGACTCAGCTATTGTTACAGG + Intergenic
996857508 5:128025734-128025756 TAATATTCAGATATTTTTAAAGG + Intergenic
997005438 5:129811298-129811320 CCAAATTCAGCTATTTATATTGG + Intergenic
997142731 5:131399949-131399971 CAAAATTCAGAAGATGGTATAGG + Intergenic
998427042 5:142037516-142037538 CAAGACTCAGCTATTGTTACAGG + Intergenic
998543327 5:143004175-143004197 CAAGACTCAGCTGTTGTTATAGG + Intronic
1000090698 5:157927421-157927443 CAAAATTCAGATCACGTTTTGGG - Intergenic
1000966505 5:167663934-167663956 AAATATTCAAATATAGTTATAGG + Intronic
1001169086 5:169400906-169400928 CAAAATTAAGAGAGAGTTATTGG + Intergenic
1002654838 5:180737656-180737678 CAAATATTAGTTATTGTTATTGG + Intergenic
1003481042 6:6533795-6533817 GAAAATCCAGAGATTTTTATTGG - Intergenic
1005748002 6:28857354-28857376 CAAGACTCAGCTATTGTTATAGG - Intergenic
1006819287 6:36878699-36878721 CAACATTCAGCTATTGTTACAGG - Intronic
1007023751 6:38548712-38548734 TATAATTCAAATATTGTTAAGGG + Intronic
1007543981 6:42677388-42677410 CAAAAAACAGACATTTTTATAGG - Intronic
1008095512 6:47335788-47335810 CAAGACTCAGCTATTGTTACAGG + Intergenic
1008098886 6:47370340-47370362 AAGAATTCAGTTAATGTTATTGG - Intergenic
1008161098 6:48076921-48076943 CAACGCTCAGCTATTGTTATGGG + Intergenic
1008206207 6:48661208-48661230 CAAAATCAAGAAATTATTATTGG + Intergenic
1008412898 6:51203508-51203530 GAAATTTCAGAGATTTTTATTGG - Intergenic
1008426396 6:51362956-51362978 CTAGATTCAGATATTTTTAATGG + Intergenic
1008758596 6:54827277-54827299 CAGAATTCATATCTTGTTGTTGG + Intergenic
1008769799 6:54964762-54964784 ACAATTTCAGATCTTGTTATTGG - Intergenic
1008792743 6:55258148-55258170 CTAAATTCAAATATTTTTAAAGG + Intronic
1008810469 6:55491706-55491728 AAAAATTCAGATAAGTTTATTGG + Intronic
1009334491 6:62469757-62469779 AAAAAATGAGATATTATTATGGG - Intergenic
1009355300 6:62737242-62737264 AAAAATTCATATATAATTATTGG + Intergenic
1009440526 6:63672772-63672794 CAATACTCAGCTATTGTTACAGG - Intronic
1009666339 6:66685886-66685908 CAAGACTCAGCTATTGTTACAGG - Intergenic
1009756750 6:67949784-67949806 TCAAATTCAGAGCTTGTTATTGG + Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010398093 6:75415239-75415261 CAATATTGATATATTATTATGGG - Intronic
1010575233 6:77521903-77521925 TCAATTTCAGAAATTGTTATTGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010696008 6:78974847-78974869 ACAATTTCAGATCTTGTTATTGG - Intronic
1010972826 6:82281061-82281083 ACAATTTCAGATCTTGTTATTGG + Intergenic
1011254304 6:85405355-85405377 CAAACATCAGTTATTGTTAAGGG + Intergenic
1011324372 6:86133167-86133189 TCAAATTCAGAACTTGTTATTGG + Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012245002 6:96916259-96916281 CAAAACTCAGATATTGTTATAGG + Intergenic
1012353800 6:98287852-98287874 AAAAAATCATATATTGTTACTGG + Intergenic
1012652645 6:101775901-101775923 AAAAATTCATATATTTTTAAAGG + Intronic
1012771675 6:103444697-103444719 CAACACTCAGTTATTGTTACAGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014162840 6:118189944-118189966 CAAGACTCAGCTATTGTTATAGG + Intronic
1014163403 6:118196227-118196249 CAAGACTCAGCTATTGTTGTAGG + Intronic
1014307047 6:119755931-119755953 TAAATTTCAGAACTTGTTATTGG - Intergenic
1014836220 6:126163719-126163741 TCAATTTCAGAAATTGTTATTGG + Intergenic
1014868536 6:126561917-126561939 TCAATTTCAGAAATTGTTATTGG - Intergenic
1015456669 6:133434240-133434262 GAAAATTCATTTATTGTCATGGG - Intronic
1015745645 6:136506830-136506852 CAACACTCAGCTATTGTTACAGG - Intronic
1016373810 6:143400188-143400210 CAAAATTCATAAATTGTAAAAGG - Intergenic
1016484152 6:144516939-144516961 CAAAATTAAGGTATTATGATTGG + Exonic
1016492596 6:144623855-144623877 CAAAATTCAAAAATTATTAAAGG - Intronic
1016690008 6:146926620-146926642 CAACATTCAGCTATTTTTACAGG - Intergenic
1016848986 6:148597475-148597497 CAAGACTCAGCTATTGTTACAGG + Intergenic
1016854845 6:148657059-148657081 CAAGACTCAGTTATTGTTACAGG - Intergenic
1016943328 6:149503010-149503032 CAAAGTTCAGACAATTTTATAGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019295877 7:274320-274342 CAAGACTCAGCTATTGTTACAGG - Intergenic
1020039338 7:4989569-4989591 CAAAATTCTGTCATTCTTATTGG + Intronic
1020393107 7:7681989-7682011 AACAATTTAGATATTGTTGTTGG + Intronic
1020504703 7:8969756-8969778 TAAAATTAATATATTTTTATGGG - Intergenic
1020584604 7:10050795-10050817 CCAATTTCAGAACTTGTTATTGG - Intergenic
1020647325 7:10830673-10830695 CAAGACTCAGCTATTGTTACAGG - Intergenic
1020689597 7:11338202-11338224 CCAAATTAAGATATTTGTATAGG + Intergenic
1020739970 7:12003321-12003343 TAAAAATGAGATAGTGTTATAGG + Intergenic
1020860088 7:13481690-13481712 CAAGACTCAGCTATTGTTACAGG - Intergenic
1021020370 7:15590863-15590885 CAAAATTCTGACAATGTTTTTGG + Intergenic
1021064952 7:16161852-16161874 TCAATTTCAGAAATTGTTATTGG + Intronic
1021314744 7:19134052-19134074 CAAAATTTAGATACTGTACTTGG - Intergenic
1021557107 7:21931102-21931124 CCAATTTCAGAACTTGTTATTGG - Intronic
1021749663 7:23783258-23783280 CAAGACTCAGCTATTGTTATAGG + Intronic
1021786027 7:24153508-24153530 CAAGACTCAGCTATTGTTACAGG - Intergenic
1021967218 7:25932336-25932358 CATAATTAAGATACAGTTATAGG - Intergenic
1022359508 7:29644643-29644665 CACAAATCAGGTGTTGTTATGGG - Intergenic
1022606470 7:31819896-31819918 CAAAATTCATATAGTATTTTGGG - Intronic
1023188200 7:37552822-37552844 CCAGATTCAGGTATTTTTATGGG - Intergenic
1023212096 7:37817269-37817291 CAAGACTCAGCTATTGTTACAGG - Intronic
1023405144 7:39826059-39826081 CAAGACTCAGTTATTGTTACAGG + Intergenic
1025292386 7:57742033-57742055 CAACACTCAGCTATTGTTACAGG - Intergenic
1025862760 7:65347334-65347356 TAAATTTCAGAACTTGTTATTGG + Intergenic
1026211547 7:68310314-68310336 CAAAAGGCAAATATTGTTACTGG + Intergenic
1026489976 7:70854816-70854838 CAAGACTCAGTTATTGTTACAGG + Intergenic
1027339117 7:77186953-77186975 CAACACTCAGCCATTGTTATAGG + Intronic
1027339205 7:77187923-77187945 CAACACTCAGCTATTGTTACGGG - Intronic
1027433909 7:78143527-78143549 CAAAATTCATATAATGTAAAAGG + Intronic
1028189816 7:87833473-87833495 GATATTTCAGATATTGTTACTGG - Intergenic
1028240730 7:88417406-88417428 CAACACTCAGCTATTGTTACTGG + Intergenic
1028370848 7:90090502-90090524 TCAATTTCAGATTTTGTTATTGG - Intergenic
1028370931 7:90091421-90091443 TCAATTTCAGATTTTGTTATTGG - Intergenic
1028459490 7:91074965-91074987 CCAATTTCAGAACTTGTTATTGG - Intronic
1028539153 7:91923379-91923401 CAAGACTCAGCTATTGTTACAGG + Intergenic
1028637326 7:93004281-93004303 CAAGACTCAGCTATTGTTACAGG - Intergenic
1028648565 7:93124803-93124825 TCAATTTCAGAAATTGTTATTGG - Intergenic
1028652542 7:93167106-93167128 TCAATTTCAGAAATTGTTATTGG + Intergenic
1029528102 7:101107835-101107857 CAAAAATCAGATCTTGTGATGGG + Intergenic
1029855166 7:103508008-103508030 TCAATTTCAGAAATTGTTATTGG - Intronic
1030423434 7:109339226-109339248 CAAAATTCAGATATCTATTTTGG - Intergenic
1030485614 7:110163520-110163542 CAAAAATCATATATTGTTTTAGG + Intergenic
1031134444 7:117871372-117871394 AAAAATTCAGAAATTATTACTGG + Intronic
1031198414 7:118646299-118646321 CAAGACTCAGCTATTGTTACAGG + Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032036642 7:128526311-128526333 CATCATTCAGATATTGTTTGTGG + Intergenic
1032331725 7:130986769-130986791 CTAAATTCATATCTAGTTATGGG + Intergenic
1032528192 7:132596056-132596078 CAAAATTCACACATTGTATTTGG + Intronic
1032671312 7:134085065-134085087 CAAGACTCAGCTATTGTTACAGG + Intergenic
1032928290 7:136635225-136635247 CAAAACTAAGAAATTGATATTGG - Intergenic
1032942880 7:136815346-136815368 TCAAATTCAGAACTTGTTATTGG + Intergenic
1034114147 7:148567922-148567944 TAAAATGCAGTTATGGTTATAGG - Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035491997 7:159287917-159287939 CCAATTTCAGAACTTGTTATTGG - Intergenic
1035558217 8:583505-583527 CAAGACTCAGCTATTGTTACAGG + Intergenic
1035833012 8:2717900-2717922 CAAAATTAAGATTTTTTCATGGG - Intergenic
1035963657 8:4166141-4166163 CAAATTTAAAATAATGTTATGGG - Intronic
1036204048 8:6792560-6792582 CAAAATTCAGATGTTGCCAATGG + Intergenic
1037412207 8:18610305-18610327 CAAGACTCAGGTATTGTTACAGG - Intronic
1037775051 8:21829054-21829076 ACAATTTCAGATCTTGTTATTGG - Intergenic
1038082991 8:24161206-24161228 TCAATTTCAGAAATTGTTATTGG + Intergenic
1038346669 8:26738842-26738864 CTAATTTCAAACATTGTTATTGG + Intergenic
1039276761 8:35941082-35941104 GAAAAATAAGATAATGTTATGGG + Intergenic
1039575596 8:38621450-38621472 CAAAATTCACCTATTTTAATTGG - Intergenic
1039678711 8:39704036-39704058 CCAATTTCAGAGCTTGTTATTGG - Intronic
1040084251 8:43323113-43323135 ACAAATTCAGAGACTGTTATTGG + Intergenic
1040420987 8:47240375-47240397 GTAAGTTCAGATATTATTATGGG + Intergenic
1040971914 8:53144458-53144480 CAATATTGTGATCTTGTTATAGG - Intergenic
1041426876 8:57731181-57731203 CAAACTTAAGCTTTTGTTATAGG - Intergenic
1041630255 8:60079559-60079581 TAAATTTCAGAACTTGTTATTGG + Intergenic
1042078537 8:65023270-65023292 CAAACTTGAGATACTGTCATTGG + Intergenic
1042419168 8:68565006-68565028 GACACTTCAGATATTTTTATGGG - Intronic
1042625943 8:70757135-70757157 CAAAACTCAAATAATGTAATAGG - Intronic
1043200196 8:77359833-77359855 CAAGATTTAGATATTCTCATAGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1045007031 8:97925259-97925281 CAAGACTCAGCTATTGTTACAGG + Intronic
1045134659 8:99202521-99202543 TTAATTTCAGAAATTGTTATTGG - Intronic
1045530426 8:102979970-102979992 AAAAATGCAGCTATTGTTACAGG + Intergenic
1045749557 8:105466855-105466877 AAAAATTCTGATATTATAATAGG + Intronic
1045778340 8:105833684-105833706 CAAAGTTCAGATTTTCTTAACGG - Intergenic
1046035180 8:108832242-108832264 CAACACTCAGCTCTTGTTATAGG - Intergenic
1046038759 8:108876818-108876840 CAACACTCAGCTATTGTTACAGG - Intergenic
1046052048 8:109035386-109035408 CTAGATTCAGATAGTTTTATAGG + Intergenic
1046227254 8:111299107-111299129 CAAAATTCACAAATTGATTTTGG + Intergenic
1046578819 8:116066676-116066698 CAATACTCAGCTATTGTTACAGG - Intergenic
1047087052 8:121529390-121529412 CAAAGTTCAGATATTGAGCTTGG + Intergenic
1047145988 8:122199929-122199951 TAAATTTCAGAACTTGTTATTGG - Intergenic
1047767366 8:128000705-128000727 CTAAAATCAACTATTGTTATGGG - Intergenic
1048887686 8:138921688-138921710 CAAAATTAAAATATTTTCATTGG + Intergenic
1049501212 8:142967699-142967721 CAAGATTCAGTTATTGTTATAGG + Intergenic
1050029488 9:1370390-1370412 ATATATACAGATATTGTTATAGG + Intergenic
1050037194 9:1449370-1449392 CAAAATGCAAATATTATTCTAGG - Intergenic
1050239578 9:3620996-3621018 TCAATTTCAGATCTTGTTATTGG + Intergenic
1050523472 9:6525608-6525630 CAAAATCTAGATGTTTTTATTGG - Intergenic
1050657625 9:7846624-7846646 CAACACTCAGCTATTGTTACAGG - Intronic
1051764866 9:20512655-20512677 CAAAGTTCATTTATTGTTTTTGG + Intronic
1051848263 9:21477340-21477362 TAAAAGGCAGATATTGTCATGGG + Intergenic
1052066889 9:24033083-24033105 CCAAATTCAGTTAGTGTTTTTGG - Intergenic
1052364435 9:27596155-27596177 AAAAATACTGATACTGTTATGGG - Intergenic
1052506175 9:29357483-29357505 TAAATTTCAGAACTTGTTATTGG + Intergenic
1052527797 9:29641941-29641963 CAAAATTGTGATATTGGTAGAGG + Intergenic
1052589688 9:30475381-30475403 AAAAATTCAGATATAATGATGGG - Intergenic
1053268263 9:36731835-36731857 CAAAACTCAGCTGTTGTTACAGG + Intergenic
1053751443 9:41260658-41260680 CAATTTTCAGATCCTGTTATTGG + Intergenic
1054164120 9:61703679-61703701 CAACACTCAGGTATTGTTATAGG + Intergenic
1054256965 9:62824987-62825009 CAATTTTCAGATCCTGTTATTGG + Intergenic
1054800318 9:69341622-69341644 CAAAAGTCAGAAATAGTTTTAGG + Intronic
1054948196 9:70819523-70819545 CAAATGTCAGATATTACTATAGG + Intronic
1055014997 9:71606762-71606784 CAAGACTCAGCTATTGTTACCGG + Intergenic
1055049711 9:71966023-71966045 CAAGACTCAGCTATTGTTACAGG - Intronic
1055052276 9:71992740-71992762 CAAGACTCAGTTATTGTTACAGG - Intergenic
1055400419 9:75917828-75917850 AAAAATTTAGAAATTATTATTGG + Intronic
1055872138 9:80894255-80894277 CAAAATTTACATATTATAATAGG + Intergenic
1055972480 9:81925466-81925488 CAACACTCAGCTATTGTTACAGG + Intergenic
1055974233 9:81940538-81940560 CAACACTCAGCTATTGTTACAGG + Intergenic
1056195450 9:84224287-84224309 CAAAACTCAGCTATTGTTACAGG - Intergenic
1056424195 9:86460225-86460247 CAAGACTCAGCTATTGTTAGAGG - Intergenic
1056430418 9:86522058-86522080 CAAGACTCAGCTATTGTTACGGG - Intergenic
1056922105 9:90800537-90800559 CAAGACTCAGCTATTGTTAAAGG - Intergenic
1057235462 9:93354406-93354428 CAAGACTCAGCTACTGTTATAGG + Intergenic
1058034825 9:100239401-100239423 CAAAATTTATATATTGTTTATGG + Intronic
1058328740 9:103731088-103731110 CAGAATTCTGAGATTATTATAGG - Intergenic
1059266085 9:113032167-113032189 CAAGACTCAGCTATTGTTACAGG + Intergenic
1059571081 9:115436551-115436573 CAAAACTCAGCTATTGTTACAGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059929673 9:119248614-119248636 TAAATTTCAGATATTGTTTAGGG - Intronic
1060344830 9:122806932-122806954 CAAATATCAGAAATAGTTATGGG - Intronic
1061447111 9:130645700-130645722 CAAATTTAAAATATTTTTATGGG - Intergenic
1061812995 9:133173796-133173818 CAACACTCAGCCATTGTTATAGG + Intergenic
1203442220 Un_GL000219v1:20189-20211 ACAATTTCAGAGATTGTTATTGG + Intergenic
1203443969 Un_GL000219v1:37444-37466 ACAATTTCAGAGATTGTTATTGG - Intergenic
1203355179 Un_KI270442v1:131153-131175 ACAATTTCAGATCTTGTTATTGG - Intergenic
1203513028 Un_KI270741v1:139098-139120 ACAATTTCAGAGATTGTTATTGG + Intergenic
1203514777 Un_KI270741v1:156353-156375 ACAATTTCAGAGATTGTTATTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186119069 X:6338927-6338949 CAACACTCAGCTATTGTTACAGG + Intergenic
1186619112 X:11218629-11218651 TCAAATTCAGAACTTGTTATTGG + Intronic
1186723536 X:12331173-12331195 TAAAATACATATATTGTTAAGGG + Intronic
1186817431 X:13251743-13251765 CAAAATTAAGAAACTGTCATTGG + Intergenic
1187007579 X:15247631-15247653 AAAAATTAAGATATTTTTATGGG + Intronic
1187592167 X:20729454-20729476 CAAATTTAAGATATTCTTAGAGG - Intergenic
1187607523 X:20902431-20902453 GAAATTTCAGAATTTGTTATTGG + Intergenic
1188092473 X:25980205-25980227 CAAATTTCAAAACTTGTTATGGG - Intergenic
1188195344 X:27225788-27225810 ACAATTTCAGATCTTGTTATTGG - Intergenic
1188319904 X:28723260-28723282 TCAATTTCAGATACTGTTATTGG + Intronic
1188416039 X:29935782-29935804 CAAAATGCAAATATGGTTGTTGG - Intronic
1188600005 X:31951368-31951390 CAAATTTCAGATTTTTTTAATGG + Intronic
1189054366 X:37684076-37684098 CAGAATTTAGCTTTTGTTATTGG + Intronic
1189144462 X:38641648-38641670 CAAAATTCAGACCTTATTGTTGG - Intronic
1189572453 X:42312757-42312779 CAAGACTCAGCTATTGTTATAGG + Intergenic
1189622816 X:42861160-42861182 CAAGACTCAGCTATTGTTACAGG - Intergenic
1189636398 X:43015125-43015147 CATAATTCAGTTAATGTTGTGGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189721557 X:43924564-43924586 CCAATTTCAGAACTTGTTATTGG + Intergenic
1190444460 X:50509552-50509574 CAAAATCAAGATATTGTCAGAGG + Intergenic
1190552498 X:51599228-51599250 CAAGACTCAGCTATTGTTACAGG + Intergenic
1190900517 X:54668284-54668306 CACAATTCAGAGCCTGTTATTGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191074122 X:56433869-56433891 CAAATTTCAGCTCCTGTTATTGG + Intergenic
1191074632 X:56439463-56439485 CAAATTTCAGCTCCTGTTATTGG - Intergenic
1191084916 X:56555381-56555403 CAAGACTCAGCTATTGTTACAGG - Intergenic
1191181828 X:57572624-57572646 TAAATTTCAGAACTTGTTATTGG - Intergenic
1191703508 X:64068217-64068239 TCAATTTCAGATCTTGTTATTGG + Intergenic
1191789748 X:64957111-64957133 CAAGACTCAGCTATTGTTACAGG - Intronic
1191793504 X:64996611-64996633 CAAAATTAAAATATTCATATAGG + Intronic
1191810349 X:65179832-65179854 TCAATTTCAGAAATTGTTATTGG - Intergenic
1192293145 X:69818691-69818713 CCAATTTCAGAGCTTGTTATTGG - Intronic
1192335179 X:70213069-70213091 TCAATTTCAGATGTTGTTATTGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193037448 X:76967522-76967544 AAAAATTCAGAATTAGTTATTGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193381834 X:80824862-80824884 CCAATTTCAGAACTTGTTATCGG + Intergenic
1193957015 X:87876158-87876180 CAAGACTCAGCTATTGTTACAGG + Intergenic
1194056152 X:89134849-89134871 CAACACTCAGCTATTGTTACAGG - Intergenic
1194170230 X:90571940-90571962 TCAATTTCAGAAATTGTTATTGG - Intergenic
1194449254 X:94022972-94022994 CACAATATAGATATTTTTATTGG - Intergenic
1194937911 X:99973207-99973229 CACAAGTCAGTTACTGTTATGGG - Intergenic
1195099786 X:101543675-101543697 ACAAATTCAGATCCTGTTATTGG - Intergenic
1195331271 X:103803311-103803333 CAACCTTCATACATTGTTATTGG - Intergenic
1195652314 X:107298182-107298204 CACTTTTCAGATATTGTTAAAGG + Intergenic
1195843522 X:109201400-109201422 CCAAATTTTCATATTGTTATAGG + Intergenic
1195886316 X:109642017-109642039 AAAAATCCAAATATTGTTAAGGG - Exonic
1196186784 X:112752563-112752585 CAACACTCAGCTATTGTTACAGG + Intergenic
1196511481 X:116517275-116517297 ACAATTTCAGATCTTGTTATTGG + Intergenic
1196598037 X:117567797-117567819 TCAATTTCAGATCTTGTTATTGG + Intergenic
1197399790 X:125975777-125975799 CAAGATCCAGAAATTCTTATAGG - Intergenic
1197532852 X:127651816-127651838 CAAAATTAAGATAGTGGTAAAGG + Intergenic
1198295078 X:135279155-135279177 TAAATTTCAGAACTTGTTATTGG + Intronic
1199318768 X:146413391-146413413 CAAAATTCAGATGTGGAAATTGG - Intergenic
1199364254 X:146960306-146960328 CAAAACTTAGCTATTGTTACAGG - Intergenic
1199828865 X:151528727-151528749 CCAAATTGAGAGATTGTTATGGG + Intergenic
1199863474 X:151822433-151822455 CAAAATTCTAATATTTTTAAGGG + Intergenic
1200516476 Y:4149706-4149728 TCAATTTCAGAAATTGTTATTGG - Intergenic
1200727554 Y:6690859-6690881 AAAAATTCAGAGATTGGTACTGG - Intergenic
1200728705 Y:6706634-6706656 AAAAATTCAGAGATTGGTACTGG - Intergenic
1200903368 Y:8456102-8456124 AAAATTTCAGATCCTGTTATTGG + Intergenic
1201492025 Y:14552251-14552273 TCAAATTCAGAACTTGTTATTGG - Intronic
1201544472 Y:15146131-15146153 CACAATTCAGAGACTGTTATTGG + Intergenic
1201642964 Y:16198905-16198927 AAAAAGTCAGGTGTTGTTATGGG + Intergenic
1201647341 Y:16249948-16249970 TCAATTTCAGAAATTGTTATTGG - Intergenic
1201655470 Y:16335353-16335375 TCAATTTCAGAAATTGTTATTGG + Intergenic
1201659851 Y:16386416-16386438 AAAAAGTCAGGTGTTGTTATGGG - Intergenic
1202094804 Y:21238182-21238204 TCAAATTCAGAACTTGTTATTGG + Intergenic