ID: 974705077

View in Genome Browser
Species Human (GRCh38)
Location 4:65503955-65503977
Sequence GTTACTGATGGTCCACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974705077_974705080 22 Left 974705077 4:65503955-65503977 CCAAATTGTGGACCATCAGTAAC 0: 1
1: 0
2: 1
3: 9
4: 86
Right 974705080 4:65504000-65504022 GTGTATATATGTAATATAAATGG 0: 1
1: 0
2: 7
3: 109
4: 795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974705077 Original CRISPR GTTACTGATGGTCCACAATT TGG (reversed) Intronic
907904941 1:58776022-58776044 GTAACTGGTGGGGCACAATTTGG - Intergenic
911091062 1:94017260-94017282 GTTACTGATGATGTTCAATTCGG - Intronic
921557817 1:216620324-216620346 AATACTGATGGTTTACAATTAGG - Intronic
1067576384 10:47411209-47411231 GTCACTGAGGGTCCACAAGGAGG - Intergenic
1069026011 10:63542777-63542799 CTTACTTAAGGTCCACAAATTGG - Intronic
1077760896 11:5096420-5096442 ATGACTGATTGTCCAGAATTAGG + Intergenic
1078380421 11:10835041-10835063 GTTACTGAAGGATCACAATATGG - Intronic
1085025715 11:73235372-73235394 GTCACTGATGGTCCATATCTGGG - Exonic
1094743638 12:33317392-33317414 GTTCCTGTCGGTCCAGAATTTGG + Intergenic
1095535414 12:43240278-43240300 TTTACTGAAGGGTCACAATTAGG + Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1099873380 12:88375472-88375494 GTTACTCATGGTACAAAAATAGG - Intergenic
1103806285 12:123576019-123576041 GTTTCTGCAGGTCCAGAATTTGG + Intergenic
1104524966 12:129512563-129512585 GTTTCTGAGGGTCAAGAATTTGG + Intronic
1108021501 13:46132412-46132434 GTATGTGATGGTCCACAAATGGG - Intronic
1117329981 14:54702785-54702807 GTGACTGATGGTCCAAATTTGGG + Intronic
1119045514 14:71315217-71315239 CTTACTCATGCTCCACACTTTGG + Intergenic
1120825685 14:88952882-88952904 TCTTCTGATGGTCCACACTTAGG - Intergenic
1124487156 15:30128679-30128701 ATTACTGATGGTACCCAACTTGG + Intergenic
1124542244 15:30597654-30597676 ATTACTGATGGTACCCAACTTGG + Intergenic
1124548948 15:30659759-30659781 ATTACTGATGGTACCCAACTTGG + Intronic
1124756369 15:32409644-32409666 ATTACTGATGGTACCCAACTTGG - Intergenic
1130664083 15:85854537-85854559 GGCACTGATGATCCACATTTGGG + Intergenic
1132150683 15:99455944-99455966 GTCACTGATGGTCCTGAGTTGGG + Intergenic
1133776168 16:8896960-8896982 CTAACTGAACGTCCACAATTGGG + Intronic
1138820180 16:60250029-60250051 CTTCCTGATTTTCCACAATTTGG - Intergenic
1142837916 17:2602891-2602913 GGTACTGAGGCTCCACAGTTGGG + Intronic
1144020035 17:11232753-11232775 GATACTGGTAGTCCAAAATTAGG - Intergenic
1144184687 17:12785934-12785956 TTTACCCATGGTCAACAATTAGG - Intergenic
1144379719 17:14682503-14682525 GTTTCAGATGTTCCTCAATTCGG - Intergenic
1148704966 17:49622026-49622048 GTTATTGATGGTCCACATGTAGG + Exonic
1149186364 17:54002241-54002263 ACTACTGATGGTCCACCATGAGG + Intergenic
1149349995 17:55776701-55776723 GCTACTGATCCTCCACAAGTAGG - Exonic
1150348093 17:64420229-64420251 GGTGCTGATGCCCCACAATTGGG + Intergenic
1153822882 18:8847383-8847405 TTCACTGATGGTCCCCAAGTGGG - Intergenic
1157141447 18:45111169-45111191 GTTGCTGATGCTCCACAAAATGG - Intergenic
1161192313 19:2964985-2965007 GTTTCTGATGGTCCAGAATCAGG - Intergenic
928209094 2:29310695-29310717 GACACTGAGGGTCCACAGTTAGG - Intronic
931427973 2:62188431-62188453 GGTACCTATGGTCAACAATTTGG - Intergenic
935655430 2:105418734-105418756 GTTACTCATGGTCCACTGTGGGG + Intronic
936744354 2:115556556-115556578 GTTTCTGCTGGCACACAATTAGG - Intronic
938584950 2:132681027-132681049 TTTTCTGATGATCCAGAATTGGG + Intronic
939158160 2:138550502-138550524 GTTATTAATGGTCCACATATAGG - Exonic
942005981 2:171700006-171700028 GTTTCTGCTGGTCAAGAATTTGG + Intronic
942406839 2:175665171-175665193 TTTACTGAGAGTCTACAATTCGG - Intergenic
944301807 2:198132228-198132250 GCTACTGATTGGCCACACTTGGG + Intronic
944976345 2:205056051-205056073 TTTACTAAATGTCCACAATTTGG - Intronic
947340542 2:229134108-229134130 GTGACTGATGGTTCTCAAATGGG - Intronic
1170101945 20:12711386-12711408 GTTTCTGTTGTTCCACAAGTTGG + Intergenic
1173736016 20:45362083-45362105 TTTACTGACTGTCCACTATTCGG + Intronic
1175218298 20:57402939-57402961 GTTTCTGATGGTCCACAGTCGGG + Intronic
1177509212 21:22061919-22061941 GTTACTGATGTTCCACAATGTGG + Intergenic
954773315 3:52994329-52994351 GTTATTGATGGTCAACACCTAGG - Intronic
959804025 3:110529407-110529429 GTAACAGATGGCCCACAATTTGG - Intergenic
961818631 3:129564097-129564119 GTTCCTGATGGCCCACAGTGAGG + Intronic
963658183 3:148086868-148086890 GTTACTGATGATCCAAAAAGTGG - Intergenic
964264946 3:154885034-154885056 GTTACTGGTGTTCCAGACTTTGG - Intergenic
967703743 3:192624840-192624862 GGTACTGATGGATCACAAATAGG - Intronic
967895517 3:194392912-194392934 GTTTCTGAGGGTCAAGAATTTGG - Intergenic
974705077 4:65503955-65503977 GTTACTGATGGTCCACAATTTGG - Intronic
974877650 4:67717659-67717681 GTTTCTGATGATCCTTAATTAGG + Intergenic
975384526 4:73740319-73740341 AATACTGAAGCTCCACAATTTGG - Intergenic
977345895 4:95815296-95815318 GTTGCTGATATTCCACATTTTGG + Intergenic
981019847 4:140014041-140014063 ATTACAGATGCTCCACAATGTGG + Intronic
982482684 4:155931947-155931969 GTTACTGATGCTTCATAATGTGG + Intronic
983692538 4:170489036-170489058 GTTTCTGTTGGTCCAGAATTTGG - Intergenic
987240797 5:15996565-15996587 TTTACTCATAGTTCACAATTAGG - Intergenic
988000089 5:25336452-25336474 GTTACTGATGGACCTTCATTAGG - Intergenic
989327533 5:40216852-40216874 GTTACTGATTGCCAAGAATTGGG + Intergenic
991411466 5:66349673-66349695 CTTACTGAAGGTACATAATTAGG + Intergenic
994171175 5:96661557-96661579 GTTGCTGCTGGTTCACAATCAGG - Intronic
1000958137 5:167566675-167566697 GTTACTGATGTTTCTCAATATGG - Intronic
1001055253 5:168444154-168444176 GTTACTGATGGTTCACACATTGG + Intronic
1001884429 5:175276341-175276363 GATACTGATGGACCACATGTGGG + Intergenic
1003070636 6:2942799-2942821 GTTACCCATGGTCCAAAAATAGG - Intergenic
1007798459 6:44370772-44370794 GTTACTTATGGCACACGATTAGG + Intronic
1008257767 6:49325499-49325521 GCTACTTATGATCTACAATTTGG + Intergenic
1011245789 6:85319781-85319803 GTCACTGATGGCACACAATATGG - Intergenic
1011278422 6:85652244-85652266 GTCGCTGTTGGTTCACAATTGGG + Intergenic
1014302432 6:119699424-119699446 ATTACTGATGGTCCAAATTTGGG - Intergenic
1015033113 6:128620116-128620138 GTCTCTGATGGTCCACCATGTGG + Intergenic
1015071342 6:129097078-129097100 GTCACTGGTGGGGCACAATTGGG - Intronic
1017394005 6:153975662-153975684 GTGACTGATGCTCCACCATCTGG + Intergenic
1030842680 7:114375569-114375591 GTTTCTGAGGGTCCAGTATTTGG + Intronic
1034253616 7:149713010-149713032 GCGACTGATGGTCCACAAATGGG + Intergenic
1047661125 8:127038062-127038084 GTTTCTGAGGGTCAAGAATTTGG - Intergenic
1055357815 9:75455400-75455422 GCTACAGATGGTCAACTATTTGG - Intergenic
1060212613 9:121719809-121719831 GTTGCTGGTGGTTCACATTTTGG - Intronic
1060437764 9:123609539-123609561 ATTACAGATGGTTCACTATTTGG + Intronic
1062139903 9:134950235-134950257 GTTATAGCTGGTCCTCAATTTGG + Intergenic
1185996288 X:4953486-4953508 GTTACTGAAGCTCAATAATTTGG + Intergenic
1186438805 X:9567241-9567263 GTTCCTGATGGCCCAGAACTGGG + Intronic
1186637684 X:11424075-11424097 GTCACTGAAGGTCCAACATTTGG + Intronic
1189890902 X:45601163-45601185 GTAACTGAGAGTCCTCAATTTGG + Intergenic
1189975712 X:46460026-46460048 CTGACTGATGGGCCACAAATTGG + Intronic
1190470805 X:50777140-50777162 GTTGCTGATGGACCAGAATGAGG + Intronic
1199068537 X:143449083-143449105 GTGACTGATGGTCTACAGATGGG - Intergenic