ID: 974707546

View in Genome Browser
Species Human (GRCh38)
Location 4:65541046-65541068
Sequence ATGAGAAAGGGGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2437
Summary {0: 1, 1: 0, 2: 30, 3: 279, 4: 2127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974707546_974707555 29 Left 974707546 4:65541046-65541068 CCTCCCTCCTTCCCCTTTCTCAT 0: 1
1: 0
2: 30
3: 279
4: 2127
Right 974707555 4:65541098-65541120 TGCAAGCACTAAATATGGAAAGG 0: 1
1: 12
2: 1094
3: 5752
4: 3783
974707546_974707554 24 Left 974707546 4:65541046-65541068 CCTCCCTCCTTCCCCTTTCTCAT 0: 1
1: 0
2: 30
3: 279
4: 2127
Right 974707554 4:65541093-65541115 AAAAATGCAAGCACTAAATATGG 0: 1
1: 0
2: 9
3: 55
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974707546 Original CRISPR ATGAGAAAGGGGAAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr