ID: 974707546 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:65541046-65541068 |
| Sequence | ATGAGAAAGGGGAAGGAGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2437 | |||
| Summary | {0: 1, 1: 0, 2: 30, 3: 279, 4: 2127} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 974707546_974707555 | 29 | Left | 974707546 | 4:65541046-65541068 | CCTCCCTCCTTCCCCTTTCTCAT | 0: 1 1: 0 2: 30 3: 279 4: 2127 |
||
| Right | 974707555 | 4:65541098-65541120 | TGCAAGCACTAAATATGGAAAGG | 0: 1 1: 12 2: 1094 3: 5752 4: 3783 |
||||
| 974707546_974707554 | 24 | Left | 974707546 | 4:65541046-65541068 | CCTCCCTCCTTCCCCTTTCTCAT | 0: 1 1: 0 2: 30 3: 279 4: 2127 |
||
| Right | 974707554 | 4:65541093-65541115 | AAAAATGCAAGCACTAAATATGG | 0: 1 1: 0 2: 9 3: 55 4: 442 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 974707546 | Original CRISPR | ATGAGAAAGGGGAAGGAGGG AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||