ID: 974710637

View in Genome Browser
Species Human (GRCh38)
Location 4:65589434-65589456
Sequence CAGTGGTTACAGAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974710637_974710645 15 Left 974710637 4:65589434-65589456 CCCACCTCCCTCTGTAACCACTG 0: 1
1: 1
2: 2
3: 21
4: 314
Right 974710645 4:65589472-65589494 GCCACTGCTGTCAGAAAACAAGG 0: 1
1: 0
2: 0
3: 23
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974710637 Original CRISPR CAGTGGTTACAGAGGGAGGT GGG (reversed) Intronic
900370911 1:2331767-2331789 CAGTGGTTACATAAGAAGGACGG - Intronic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
903033072 1:20477150-20477172 AAGAGGTTAGAGAGGGGGGTTGG - Intergenic
904175969 1:28629151-28629173 AACTGATAACAGAGGGAGGTGGG + Intronic
904886515 1:33742588-33742610 TCGTGGTTACAGAGGGGGTTGGG - Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905279263 1:36838556-36838578 CAAGGGTTACAGAGGAAGATGGG - Intronic
906944783 1:50286428-50286450 CAGTGGGTAGAGTGGAAGGTAGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907489586 1:54800556-54800578 CAGTCCTCCCAGAGGGAGGTAGG + Intronic
910969492 1:92841194-92841216 TGGTGGTTACAGAGGCTGGTGGG - Intronic
911200021 1:95034957-95034979 CACTGGTAACAGTGGTAGGTGGG - Intronic
911785813 1:101945480-101945502 CAGTGGTTTCTGTGGGAGGAGGG + Intronic
912127412 1:106555836-106555858 TAGTGGTTACAGAGGGCCTTGGG + Intergenic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
916511439 1:165475305-165475327 CAGTGATTACAAAATGAGGTGGG - Intergenic
916785338 1:168083047-168083069 GTGTGGCTTCAGAGGGAGGTGGG - Exonic
916892228 1:169123035-169123057 AAGTGGTTACATAATGAGGTGGG - Intronic
916996051 1:170302427-170302449 CAGTGGTTATAGAGTGAGGAAGG - Intergenic
920538410 1:206758038-206758060 CGGTGGGTACAGAAGCAGGTTGG - Intergenic
922997587 1:229977000-229977022 TGGTGGTGACAGAGGGAAGTAGG + Intergenic
923265600 1:232310844-232310866 CAGTGGGTAGATAAGGAGGTGGG + Intergenic
923372775 1:233328836-233328858 AAGTGGGGCCAGAGGGAGGTGGG + Intronic
923693963 1:236228081-236228103 CACTGCTTAGAGAGAGAGGTTGG - Intronic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
1063450781 10:6148555-6148577 CGGTGGTTAGAGTGGGAGGAAGG + Intronic
1064847185 10:19668265-19668287 CTGTGGTGACAGTGGGAGTTTGG - Intronic
1065732530 10:28722449-28722471 CAGTGGACCCAGAGCGAGGTGGG - Intergenic
1067395903 10:45917112-45917134 CATTGGTCACATAGGGAAGTAGG - Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067864227 10:49886237-49886259 CATTGGTCACATAGGGAAGTAGG - Intronic
1069562274 10:69439310-69439332 CTGTGGCTATAGAGGAAGGTGGG - Intergenic
1069967765 10:72135608-72135630 CAGTAGTTACAGAGTGAGGTGGG + Intronic
1069984178 10:72272842-72272864 CAGTGGTTGCTGAGGGTGGGTGG - Intergenic
1070786538 10:79165413-79165435 CAGAGCTTCCAGAGGGAGGGAGG + Intronic
1071526531 10:86362865-86362887 CAGTGGGTGTAGTGGGAGGTGGG - Intronic
1072867985 10:99084824-99084846 CAGTGGTAACAGGGGCAAGTTGG - Intronic
1073152771 10:101323104-101323126 AAGTGGAGGCAGAGGGAGGTAGG + Intergenic
1074132170 10:110589515-110589537 CAGTGGTTGCAGATGGATGGGGG - Intronic
1074824090 10:117202150-117202172 CAGGGGTTGCAGAGAGAGGCTGG + Intronic
1074967364 10:118503232-118503254 CAATGTTTACATAAGGAGGTGGG - Intergenic
1075470871 10:122688045-122688067 CTCAGGTTTCAGAGGGAGGTTGG + Intergenic
1075988331 10:126808600-126808622 CAGTGGTTATCTATGGAGGTAGG + Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1077612723 11:3654038-3654060 CAGTGAGTACAGACAGAGGTAGG - Intronic
1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG + Intergenic
1078109599 11:8381988-8382010 CTGTGGTTACAGAGGGATATGGG - Intergenic
1079003354 11:16775588-16775610 CAGGGGTTAGAGAGAGAGGGAGG + Intergenic
1079751108 11:24198637-24198659 GAGTGGTTGCAGAGGAAGGCTGG - Intergenic
1080620186 11:33980803-33980825 CAGTTGTCACAGAAGGAAGTTGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081451351 11:43173376-43173398 CAGCTGTTACAGAGGTGGGTCGG - Intergenic
1081828649 11:46085399-46085421 CAGTGATGACTGAGGGAGATAGG - Intronic
1083407788 11:62470774-62470796 AAGAGGTGACAGATGGAGGTTGG - Intronic
1087191289 11:95257241-95257263 TAGAGGTTTCAGAGGGAGCTTGG + Intergenic
1087847945 11:102994420-102994442 CAGGAGTTTCAGAGGGATGTGGG + Intergenic
1088287099 11:108200585-108200607 CTCTGGTTAGAGAAGGAGGTGGG - Intronic
1089769592 11:120793700-120793722 CAGTGGTTACAGGTGAAGGGTGG + Intronic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1094815989 12:34185581-34185603 CAGTGGTTACAGTGGGCCTTGGG - Intergenic
1096154601 12:49334986-49335008 CACAGGCTGCAGAGGGAGGTTGG - Intronic
1096511511 12:52132238-52132260 CAGTGATTGCACAGGGAGGGGGG + Intergenic
1097054138 12:56239920-56239942 CTGGGGTTGGAGAGGGAGGTAGG + Exonic
1098777459 12:74638894-74638916 CAGTGGTTGAAGAGAGAGTTAGG + Intergenic
1100048814 12:90418565-90418587 CAGTGGTTACCAGGGGTGGTAGG + Intergenic
1101120378 12:101573170-101573192 GAGTGGTTACTGAGGGAGTAGGG + Intronic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1102940260 12:116934964-116934986 CAGGGGTTAGAGATGGAGCTGGG - Intronic
1104636500 12:130440797-130440819 CAGTGGTGTCAGGGGTAGGTGGG - Intronic
1104685681 12:130782655-130782677 GTGTGGTTTCAGAGGGAGCTGGG - Intergenic
1104882915 12:132084616-132084638 GAGTGTTCACTGAGGGAGGTGGG - Intronic
1105430688 13:20334550-20334572 CAGTGGTGGCAGTGGGAGGTGGG - Intergenic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1110545608 13:76751951-76751973 TTTTGGATACAGAGGGAGGTAGG - Intergenic
1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG + Intergenic
1110780986 13:79464734-79464756 CAGTGTTTTCAGACGGTGGTGGG + Intergenic
1111579661 13:90206922-90206944 AAATGGTTAAAGAGGGAGGCTGG + Intergenic
1113885687 13:113657306-113657328 CAGGGGTCGCAGGGGGAGGTGGG + Intronic
1116057975 14:39886543-39886565 CAGTGGTTACAGAGGGCCTTGGG + Intergenic
1117925669 14:60776714-60776736 AAGTGGTTCCAGAGGGTGATGGG + Intronic
1118110756 14:62716435-62716457 CAGAGGTTAGAGAAGTAGGTAGG - Intronic
1118207932 14:63740557-63740579 CAGTGGTAAGAAAGGCAGGTGGG - Intergenic
1118781706 14:69012960-69012982 CACTGGTTTAGGAGGGAGGTGGG - Intergenic
1119509003 14:75196604-75196626 CAGTGGTGAGAGTGGGAGGTGGG - Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1120996358 14:90421276-90421298 CAGTGTTTGAAGAGGGAGATTGG - Intergenic
1121452063 14:94014986-94015008 CACTGAATTCAGAGGGAGGTTGG + Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1125750689 15:42025630-42025652 GCTTGGGTACAGAGGGAGGTAGG - Intronic
1127445902 15:59062853-59062875 TAGTTCTTACAGTGGGAGGTGGG + Intronic
1128596242 15:68952909-68952931 CGGTGGTTAGACAGGGAGGGGGG - Intronic
1130085338 15:80773924-80773946 CAGTGCTCACAGCTGGAGGTAGG + Intergenic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130243570 15:82221308-82221330 CAGTGCTTACGGAGAGAGGAGGG - Intronic
1130456898 15:84119973-84119995 CAGTGCTTACGGAGAGAGGAGGG + Intergenic
1131133648 15:89916195-89916217 GAGTTGGCACAGAGGGAGGTAGG - Intergenic
1132147192 15:99436056-99436078 CAGAGGTTTGAGAGGGAGCTGGG + Intergenic
1132358446 15:101191406-101191428 CAGGGGTTACAGGGGAAGGAAGG + Intronic
1132854831 16:2040069-2040091 CAGTGCTGACAGAGGGCGGGCGG + Intronic
1133771009 16:8867274-8867296 CAGGGGTCACAGAGGGAGTGGGG - Intronic
1133778722 16:8919755-8919777 CATTGTGTACAGAGGGAGATGGG - Intronic
1134317413 16:13131868-13131890 CAGTGGTTAATAAGGGAGGATGG - Intronic
1134888314 16:17814986-17815008 TAGTGGATACATAGGTAGGTAGG + Intergenic
1135940931 16:26821158-26821180 CATTGGTCTGAGAGGGAGGTGGG + Intergenic
1136061082 16:27726887-27726909 GAGAGGTCCCAGAGGGAGGTGGG + Intronic
1136717274 16:32290552-32290574 CAGAGGTGACAGACGGTGGTGGG + Intergenic
1136835649 16:33496806-33496828 CAGAGGTGACAGACGGTGGTGGG + Intergenic
1137526318 16:49239517-49239539 TAGTAGGAACAGAGGGAGGTGGG - Intergenic
1138399551 16:56734417-56734439 GAGTGGTAACAGAAGGAGTTGGG + Intronic
1138877902 16:60975172-60975194 CACTGGTAACATAGGGAGATTGG + Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141805684 16:86340064-86340086 CAGAGGCTGGAGAGGGAGGTGGG - Intergenic
1203009155 16_KI270728v1_random:227226-227248 CAGAGGTGACAGACGGTGGTGGG - Intergenic
1203145828 16_KI270728v1_random:1797121-1797143 CAGAGGTGACAGACGGTGGTGGG + Intergenic
1142612140 17:1114785-1114807 CAGTGGTTAGAGATGCTGGTGGG + Intronic
1144948355 17:18981231-18981253 CATAGGTCACAGGGGGAGGTGGG + Intronic
1146937869 17:36823877-36823899 CTGTGGGTACAGGGGAAGGTGGG + Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147340525 17:39750975-39750997 CAGGGGTCGCAGAGGGAGTTCGG + Intergenic
1147678620 17:42224708-42224730 AGGTGGGTCCAGAGGGAGGTGGG + Intronic
1147987328 17:44314220-44314242 CTGTGGGTTCACAGGGAGGTTGG + Intronic
1150004222 17:61459889-61459911 CAGTGGTTGCTGAAGGAGGGGGG - Intronic
1151392948 17:73800083-73800105 CAGTGGTTTCAGAGGTGGGGAGG + Intergenic
1151617877 17:75226169-75226191 AAATGGTTACAGTGGGGGGTGGG - Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152103663 17:78316726-78316748 CAGGGGTCCCAGAGGGTGGTGGG - Intergenic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1154033522 18:10775457-10775479 CGGTGGTTGCAGTGTGAGGTGGG + Intronic
1154140650 18:11821722-11821744 CACTGTTTGCAGAGGCAGGTGGG + Intronic
1154345154 18:13537225-13537247 CATTGCTTACAGAAGGGGGTAGG + Intronic
1154503074 18:15005989-15006011 CAGGGGTCACAGAGGATGGTGGG + Intergenic
1156410993 18:36828534-36828556 CCGTTGTTACAGAGGAAAGTGGG - Intronic
1157325151 18:46663595-46663617 AAGTGGTCACACAGGGTGGTGGG - Intergenic
1157609824 18:48949463-48949485 AAGGGGGTGCAGAGGGAGGTGGG - Intronic
1158269911 18:55701449-55701471 CAGAGGTTGCAAAGGGTGGTGGG - Intergenic
1158314989 18:56202170-56202192 CAGTAGCTATAGAGAGAGGTAGG - Intergenic
1159905228 18:74083740-74083762 AAGTGGTTACAGAGGGTTGGCGG - Intronic
1160288711 18:77570787-77570809 CAGCGTTTTGAGAGGGAGGTGGG - Intergenic
1161218484 19:3106559-3106581 GAGAGGTTGCAGAGGGAGGCAGG - Intronic
1162102493 19:8348119-8348141 CAGTGGTTACTTAGGGAGTGAGG - Intronic
1162491603 19:10995721-10995743 CAGAGCTTACAGGGGCAGGTGGG + Intronic
1162965965 19:14156241-14156263 CAGTGCTCACTGAGGGAGGCAGG - Intronic
1163207420 19:15813828-15813850 AAGTGGAGAGAGAGGGAGGTGGG + Intergenic
1165108449 19:33487756-33487778 CAGTGGTGACAGGGTGGGGTGGG + Intronic
1165454457 19:35902644-35902666 CAGTGGTTACAGGGGATGGTAGG + Intronic
1166504804 19:43364524-43364546 ATCTGATTACAGAGGGAGGTCGG - Intergenic
1166505736 19:43370390-43370412 ATCTGATTACAGAGGGAGGTCGG + Intergenic
1167306165 19:48710987-48711009 CATGGGTCACAGAGGGAGGGAGG - Intergenic
1168508541 19:56956129-56956151 CAGTGGTTACGGAGGGGTTTGGG - Intergenic
926387798 2:12354587-12354609 GAGTGGTGACAGGGGAAGGTGGG - Intergenic
926575899 2:14580961-14580983 CGGTGGTTACAGAGGCTGGAGGG - Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
930166038 2:48204695-48204717 CAGTGGTGGGAAAGGGAGGTGGG + Intergenic
931212254 2:60208354-60208376 CAGTGGAGACAGAGGCAGGTTGG - Intergenic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
932308250 2:70719144-70719166 CAGTGGTGACAGCTGGTGGTGGG + Intronic
933102180 2:78274583-78274605 GCTTGGATACAGAGGGAGGTGGG + Intergenic
933445660 2:82377163-82377185 AAGTGGTTTCAGATGGAGATGGG + Intergenic
933844929 2:86317614-86317636 CAGTGGTGACAGGTGGAGTTTGG - Intronic
936654222 2:114466000-114466022 TAGTGATTCCAGAGGCAGGTAGG - Intronic
937984603 2:127632887-127632909 CCGTGGTCACAGAGAGAGGTGGG + Intronic
941122367 2:161545654-161545676 TAGTGGTAACTGAGGGAGGCAGG + Intronic
941672479 2:168310077-168310099 CAGTGGTTACAGTGGGCCTTGGG - Intergenic
942862892 2:180636714-180636736 TAGTGGTTACAGAGGGCCTTGGG + Intergenic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
944358707 2:198825261-198825283 CAGTGCTTGCATAGGCAGGTGGG - Intergenic
944476319 2:200110417-200110439 GAGTAGTACCAGAGGGAGGTAGG - Intergenic
944889730 2:204104967-204104989 CAGTGGTTCCAGAGGGTTCTCGG + Intergenic
944891414 2:204120904-204120926 CAGTGGCTACAGAGGCAGCCAGG - Intergenic
944999456 2:205332627-205332649 GAGGGGTTTGAGAGGGAGGTTGG + Intronic
945884745 2:215363464-215363486 CAGTGATTACATGGGGAGGGAGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
947004585 2:225496230-225496252 CTGAGGTTACAGAGGGAGTGAGG + Intronic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
948303002 2:236922378-236922400 CAGTGGATGGAGAGGAAGGTTGG + Intergenic
1169400251 20:5273714-5273736 CAGTGGAGACACAGGCAGGTGGG - Intergenic
1170588950 20:17756583-17756605 CAGTGGGGACAGAGGCAGATTGG + Intergenic
1171187568 20:23133718-23133740 CACTGGTTAGGGAGGGAGGAAGG + Intergenic
1171235970 20:23525153-23525175 GAGTGGTTACAGAGACAGCTTGG + Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171777848 20:29387481-29387503 TAGTGGTTACAGTGGGCCGTGGG - Intergenic
1172277826 20:33690024-33690046 GAGTTGTGGCAGAGGGAGGTGGG + Intergenic
1172470727 20:35192672-35192694 GCTTGGGTACAGAGGGAGGTGGG - Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1174049950 20:47760550-47760572 CACTGTTTTCAGAGGCAGGTGGG - Intronic
1176908263 21:14530739-14530761 CAGTGGTTACAGAAGATAGTGGG + Intronic
1178664477 21:34534409-34534431 CTATGGTGACAGCGGGAGGTGGG - Intronic
1179174660 21:38999735-38999757 CAGTGGTTTCAGATGGGGATGGG + Intergenic
1180186638 21:46143323-46143345 GAGTGGGGAGAGAGGGAGGTGGG - Intronic
1181542447 22:23580528-23580550 CTGAGGTCACACAGGGAGGTGGG + Intergenic
1181956142 22:26589439-26589461 CGGAGTTTACGGAGGGAGGTTGG + Intronic
1182030239 22:27153539-27153561 CAGTGGTTACCAAGAGTGGTTGG - Intergenic
1183320150 22:37160325-37160347 CAGTGGGTACAGGAGAAGGTGGG + Intronic
1183500221 22:38174442-38174464 GAGTGGGAACAGAGGGAGATTGG + Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1183754422 22:39746904-39746926 CATGGGTTGCAGAGGTAGGTGGG + Intronic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1183808725 22:40236273-40236295 CAGAGGATACAAAGGGGGGTAGG - Intronic
1185238898 22:49730420-49730442 CGATGGTTGCAGAGGGATGTGGG - Intergenic
950672026 3:14532910-14532932 CAATGGTTACAGCTGCAGGTGGG - Intronic
952014466 3:28940521-28940543 CAGTGTTTACAGAGGAAGAAGGG - Intergenic
953475003 3:43197951-43197973 CAGTGGTTGCCTTGGGAGGTGGG + Intergenic
953847636 3:46440707-46440729 CAGTGATTACTGAAGGAGGGAGG + Intronic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
954335671 3:49915842-49915864 CAGTGGTAACAGAGCTAGCTGGG + Intronic
954695827 3:52425227-52425249 CAGTGGGTAGAAAGGGAGCTTGG + Intergenic
954844011 3:53538953-53538975 GAGTGGTGACTGAGGGAAGTGGG - Intronic
956087189 3:65624615-65624637 CAGTTGTTACAGAGAGCGGAAGG + Intronic
956276704 3:67509946-67509968 CAGTGGTGAGAGATGGAGGTGGG + Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
959724919 3:109532711-109532733 CAGTGGTTACAGCAGGACTTGGG - Intergenic
962678110 3:137771002-137771024 CGGTGATAACCGAGGGAGGTGGG + Intergenic
964496221 3:157293176-157293198 GAGTGGGTGGAGAGGGAGGTAGG + Intronic
966252782 3:177885455-177885477 CAGTGGATACATTAGGAGGTAGG - Intergenic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971969631 4:33604804-33604826 CAGTGGTTGCACAGGAAAGTGGG + Intergenic
972278345 4:37580731-37580753 TAGTGGTTACAGAGGGCCCTGGG - Intronic
972452246 4:39213557-39213579 CAGAGGTTAGAGATGGAGCTGGG + Intronic
973919709 4:55672984-55673006 CAGTGGTTACTGTGGGACTTGGG - Intergenic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
974769986 4:66400413-66400435 TAGTGGTTACAGAGGGCCTTGGG - Intergenic
976352888 4:84080711-84080733 CAGTGGTGTGAGTGGGAGGTAGG - Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
978896519 4:113895103-113895125 CAGTGGTTGCAGATGGAAGTTGG - Intergenic
981233210 4:142383767-142383789 CAGTGGTTGCACAGGCAGGAGGG + Intronic
983540013 4:168899164-168899186 TAATATTTACAGAGGGAGGTGGG + Intronic
985052100 4:186001092-186001114 CAGTGCTTACAGAAAGAGGGAGG - Intergenic
985224474 4:187745249-187745271 CAGAGGTTTCAGCGGTAGGTTGG - Intergenic
986046734 5:4045063-4045085 CAGTGGTTACAGCAGGTGTTGGG + Intergenic
986286776 5:6365123-6365145 CAGGGGGTACTGAGGGAGATGGG - Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
990389861 5:55307789-55307811 CAGTGGATAAAGAGCGAGGGCGG - Exonic
991237856 5:64419561-64419583 CAGTGGTTACAGTGGGCCTTGGG + Intergenic
993136888 5:83980026-83980048 TATTGGTTACAGTGAGAGGTGGG - Intronic
993590807 5:89793271-89793293 CAGTGGTTACCAAGGGAGCAAGG + Intergenic
994059286 5:95456211-95456233 CAGTGGTTAGTGAGAGAGCTGGG + Intergenic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
995266078 5:110162428-110162450 CAGTGGTTACTAGGGGTGGTGGG + Intergenic
997109987 5:131064491-131064513 CAGTGGCTAGAAAGGCAGGTAGG + Intergenic
999078089 5:148816409-148816431 CAGTGTTTACATGGGGAGATAGG + Intergenic
1000064222 5:157681278-157681300 GAGAGGTTACTGAGGGAGGCAGG - Intergenic
1001766842 5:174255770-174255792 CAGTGTTTAAACTGGGAGGTAGG + Intergenic
1001948834 5:175801852-175801874 CATTGCTTACAGAGCAAGGTGGG - Intronic
1002018781 5:176348149-176348171 CTGTGGTTTCAGAGGGAGAAGGG - Intronic
1003635261 6:7826107-7826129 CAGTGGTGCCTGAGGGTGGTTGG + Intronic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1005412678 6:25566979-25567001 CACTGGTTACAGTGGGTGGGTGG - Intronic
1005462509 6:26082669-26082691 CAGAGGCTACAGAGGGATCTTGG - Intergenic
1005849573 6:29811551-29811573 CAGTGGTGGCAGAGAGAGTTAGG - Intergenic
1007275063 6:40667271-40667293 CAGTGAATACAGAGGTGGGTGGG - Intergenic
1007558723 6:42787849-42787871 TAGTGGCTTCAGAGGGAGATGGG + Intronic
1007921324 6:45612149-45612171 CAGTGCTTAATGGGGGAGGTGGG + Intronic
1008314798 6:50026416-50026438 TAGTGGTTACAGAGGGCCTTGGG + Intergenic
1013531047 6:111019137-111019159 CAGAGGTTACAGAGAGTGGGCGG + Intronic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1015666346 6:135634049-135634071 CAATGGGTACAGAGGCAGGTAGG - Intergenic
1017550242 6:155498171-155498193 CAGTGGTTACAGAGGGAGTTTGG + Intergenic
1017739071 6:157389768-157389790 CAGTGGGTACAAAGGGTGGAAGG - Intronic
1019268825 7:134538-134560 CAGTGGATACAGAGAAATGTGGG - Intergenic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019442055 7:1052451-1052473 TGGTGGTAACAGTGGGAGGTAGG + Intronic
1019490347 7:1310261-1310283 CAGAGGTGACACAGGGAGTTAGG + Intergenic
1019598165 7:1868054-1868076 CAGTGCTTACAGAGGTCAGTAGG - Intronic
1019892877 7:3960594-3960616 CAGTGGTTACAAAGCACGGTGGG - Intronic
1021919295 7:25467935-25467957 CCATGACTACAGAGGGAGGTGGG - Intergenic
1023195029 7:37627247-37627269 CAGTGGTTAAGGAGGGAGTGAGG - Intergenic
1023311653 7:38893407-38893429 AAATGGTAACAGAGTGAGGTGGG - Intronic
1023709287 7:42974748-42974770 GCGTGGGCACAGAGGGAGGTTGG + Intergenic
1027246532 7:76371339-76371361 CAGAGGATGCAGAGGAAGGTAGG + Intergenic
1027484771 7:78747727-78747749 CCGTGGTGACTGAGTGAGGTTGG + Intronic
1028960225 7:96740327-96740349 CTGGGGTGACAGAGGGAGTTAGG + Intergenic
1029882866 7:103835280-103835302 CAGGAGTTAAAGAGGGAGGTAGG + Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1031572519 7:123376672-123376694 TCCTGGTTACTGAGGGAGGTTGG + Intergenic
1032789503 7:135232112-135232134 CAGTGGTTGGGGCGGGAGGTGGG + Intronic
1032796810 7:135284146-135284168 AAGTGGCAACAGATGGAGGTGGG - Intergenic
1032902071 7:136321072-136321094 CAGTGGTGGCAGCTGGAGGTGGG + Intergenic
1033207370 7:139434495-139434517 TACTGCTTACAGAGGGAGGGAGG - Intergenic
1034670981 7:152858355-152858377 CATCGCTTACAGAGGGAGGAAGG + Intergenic
1037354048 8:17998643-17998665 TAGTGGTTACAGAGGGTCTTGGG - Intronic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1041117561 8:54554670-54554692 CTGTGGTTGCCGAGGGAGGGAGG + Intergenic
1041616134 8:59908166-59908188 TAGTGGTTACAGAGAGACTTGGG + Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1046728169 8:117696490-117696512 AAGTTGTTACGGAGGGAGGGAGG + Intergenic
1047215882 8:122875740-122875762 CCGTGGTTACACAGTGAGATGGG + Intronic
1047574056 8:126133515-126133537 CAGTGGTGGCAGTGGAAGGTGGG - Intergenic
1047893602 8:129340675-129340697 CAGATCTTACAGAGGGTGGTGGG - Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048632197 8:136256427-136256449 CATTGGTGACTGAGGGAGGAAGG - Intergenic
1049328588 8:142037867-142037889 CAGTAAGGACAGAGGGAGGTGGG - Intergenic
1050194288 9:3064457-3064479 CAGAGGTTACAGAAGTAGGGTGG - Intergenic
1050431780 9:5569470-5569492 CAGTGGGTTGAGAGAGAGGTTGG - Intronic
1050699255 9:8319044-8319066 TAGGGGTTACAGAGGGAAATTGG - Intronic
1053196876 9:36126438-36126460 CTGTGGTTACACAGGGAGTCAGG + Intergenic
1053204569 9:36174975-36174997 TAGTGGTTACAGAGGGCCTTGGG + Intergenic
1055185749 9:73451774-73451796 CAGTTATTACAGCGTGAGGTAGG + Intergenic
1056069295 9:82969274-82969296 TGGTGGGTACAGAGGGACGTGGG - Intergenic
1059503426 9:114776431-114776453 AAGTGGCTGCAGAGGGAAGTGGG + Intergenic
1060495237 9:124113473-124113495 CTGTGGCTGCAGAGGGAGCTAGG + Intergenic
1060505265 9:124192906-124192928 CAGTGGTTACAGGGGTTGGGTGG - Intergenic
1061111215 9:128572680-128572702 AAGTGGTAGCAGAGGAAGGTGGG + Intronic
1062144481 9:134981398-134981420 TAATGGTTATACAGGGAGGTGGG + Intergenic
1062347579 9:136122504-136122526 CCCTGGTTTCACAGGGAGGTAGG - Intergenic
1185461611 X:335262-335284 CAGAGGTGACAGACGGTGGTGGG + Intronic
1185933502 X:4229795-4229817 CAGTGGATAGATAGGTAGGTAGG - Intergenic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1187090186 X:16088231-16088253 CAGTGGATAGAGGGGAAGGTTGG - Intergenic
1188440988 X:30215315-30215337 CAGTGGGGGCTGAGGGAGGTGGG + Intergenic
1190428396 X:50354164-50354186 GAGTGGCTACAGAGGTAAGTAGG + Intergenic
1190498496 X:51052250-51052272 GAGGAGTTACAGAGGGAGATTGG + Intergenic
1191130520 X:57003563-57003585 CAGAGGCTACAAAGGGAAGTGGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1194424440 X:93719127-93719149 CAGTGGTTACAGAGGGGCAAGGG - Intergenic
1194558697 X:95394182-95394204 TAGTGGTTACAGAGGGTCTTAGG + Intergenic
1194854598 X:98914205-98914227 CTCTGGTTTCAGAGGGGGGTAGG + Intergenic
1195090044 X:101450196-101450218 TAGTGGTTACAGAGGGCCTTGGG - Intronic
1195823427 X:108971075-108971097 TAGTGGTTACAGAGGGCCATGGG + Intergenic
1196387610 X:115175365-115175387 CAGTGGTTACACAGAAAGGTAGG - Intronic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic