ID: 974712312

View in Genome Browser
Species Human (GRCh38)
Location 4:65614665-65614687
Sequence CTGTTTATTAGGAGAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974712312 Original CRISPR CTGTTTATTAGGAGAAAACC TGG Intronic
901474366 1:9479398-9479420 CTGTATCTTTGGAGAAAACTTGG - Intergenic
901976815 1:12951655-12951677 CTTTTTATTAGGTGACAACATGG - Intronic
902008355 1:13250115-13250137 CTTTTTATTAGGTGACAACATGG + Intergenic
902389231 1:16093016-16093038 CCCTTTATTAGTAGAGAACCAGG - Intergenic
903045318 1:20560219-20560241 CTGTCTGTTAGGAGAATTCCAGG - Intergenic
905227412 1:36488294-36488316 CAGGTTTTTAGGAGAAAACATGG - Intergenic
905391668 1:37639644-37639666 CTGTTTCCAAGGAGAAAAACTGG - Intergenic
907000732 1:50851969-50851991 CTGATTCTCAGGAGAAAACTTGG - Intronic
909505648 1:76386740-76386762 CTGGTTATCAGGAGATAAGCAGG - Intronic
911347249 1:96711893-96711915 ATTCTTAATAGGAGAAAACCAGG - Intergenic
912923816 1:113895380-113895402 CTGATTATTTTGAGAAAACTTGG - Exonic
913563153 1:120043644-120043666 CTGCTTATTAAAACAAAACCAGG + Intronic
913634970 1:120749946-120749968 CTGCTTATTAAAACAAAACCAGG - Intergenic
914283749 1:146203002-146203024 CTGCTTATTAAAACAAAACCAGG + Intronic
914544780 1:148653738-148653760 CTGCTTATTAAAACAAAACCAGG + Intronic
914621793 1:149416941-149416963 CTGCTTATTAAAACAAAACCAGG - Intergenic
914935444 1:151975158-151975180 CTTTTTAATAGAAGAAAAGCAGG + Intergenic
915698674 1:157770010-157770032 CTGCTTCTTCAGAGAAAACCAGG - Exonic
919122517 1:193358838-193358860 CTGTTTCTTTGGAGAAACCCTGG - Intergenic
919415114 1:197298293-197298315 CTGGTTAATAGGAGGAAAACAGG + Intronic
920812016 1:209295036-209295058 CTGTTTACTAGATGAAGACCTGG + Intergenic
921348838 1:214214782-214214804 CTTTTAATTACAAGAAAACCTGG + Intergenic
921988312 1:221336251-221336273 CTGTTTATGAGGAGGAAAAGAGG - Intergenic
924026652 1:239840434-239840456 CAGTTTATTAGGAGTTAAACTGG - Intronic
924280582 1:242433023-242433045 CTCTTTATTATAAGAAAACAGGG - Intronic
1065823358 10:29547315-29547337 ATATTTATTAGGAAAATACCTGG - Intronic
1066183276 10:32984092-32984114 GTGGTAATTAAGAGAAAACCTGG - Intronic
1066700949 10:38127586-38127608 CAGTTTGTTAGTAGAACACCTGG + Intergenic
1067375082 10:45720361-45720383 CTGTTTAATAGGAAAAGGCCTGG + Intergenic
1067882900 10:50062002-50062024 CTGTTTAATAGGAAAAGGCCTGG + Intergenic
1068905705 10:62319388-62319410 CTGTTTACTCGGAGAACACAAGG + Intergenic
1069053497 10:63819256-63819278 TTGTTTACTGGGAGAAAAGCTGG + Intergenic
1070477642 10:76845863-76845885 CTGTTAATTTGGAGAAAATAAGG + Intergenic
1070922970 10:80200384-80200406 CTGTGTTTTAGGAGAATACATGG - Intronic
1070994810 10:80768614-80768636 CTAATTATTAGAAGAAAACCAGG + Intergenic
1072675294 10:97461166-97461188 CTCTGTATTATGAGAATACCAGG - Intronic
1072968639 10:99997228-99997250 CTGTCTAAAAGAAGAAAACCAGG + Intronic
1078910554 11:15727268-15727290 ATGTTTATGGGAAGAAAACCTGG + Intergenic
1081498621 11:43643590-43643612 GTTTTTTTTAGGGGAAAACCTGG - Intronic
1084991902 11:72933696-72933718 CTGTTTAATTGAAGAGAACCAGG - Intronic
1086357205 11:86015031-86015053 CTCTGTTTTAGTAGAAAACCAGG - Intronic
1089877741 11:121741946-121741968 CTCTTTATTTGGAGAGAACTTGG + Intergenic
1091258828 11:134217640-134217662 GTGTTTAGTAGGAGAAGACATGG - Intronic
1092770703 12:11894004-11894026 TTGTTCTTTATGAGAAAACCCGG + Exonic
1093729205 12:22548729-22548751 CTGTTTAGTAGAAGACTACCAGG - Intergenic
1093757072 12:22864440-22864462 CTGTTTATTGGGAAAATACTTGG - Intergenic
1098683425 12:73387345-73387367 CAGTTTATTAGCAGTAATCCTGG + Intergenic
1099782595 12:87216439-87216461 CTGTTTCAGAGGAGAAAAACTGG + Intergenic
1099848380 12:88058741-88058763 CTGTTCATCAGGAAGAAACCAGG + Intronic
1101005837 12:100399984-100400006 CATTTTATAAGGAGAAAGCCAGG - Intronic
1101092839 12:101305129-101305151 CTGGTTTTCTGGAGAAAACCAGG + Intronic
1103074096 12:117968531-117968553 CTGTTTCTCAGAAGCAAACCAGG + Intronic
1103329347 12:120143110-120143132 ATGTTCATTAGTAGAAAACTTGG - Intronic
1103698314 12:122834957-122834979 CTGGTTAATTGGAGAAAATCTGG - Intronic
1105620858 13:22064878-22064900 ATGTAAATTAAGAGAAAACCAGG + Intergenic
1106656519 13:31752630-31752652 TTGTTTGTTTGGAGAAAACTAGG - Intronic
1107441961 13:40435885-40435907 CAGTATATTTGGAGAAAACTAGG - Intergenic
1108041584 13:46344235-46344257 CTGTTTAATGGGAGAGATCCTGG - Intronic
1108426785 13:50310371-50310393 CTGCTTTTTAGTAGGAAACCTGG + Intronic
1108984246 13:56563211-56563233 CTGTAGATTAGAAGAAAACTAGG - Intergenic
1109705252 13:66081814-66081836 TTGTTGATGATGAGAAAACCTGG - Intergenic
1109955878 13:69565347-69565369 CTTTTTCTTAGGAGAATGCCGGG - Intergenic
1113317891 13:109203555-109203577 CTGAGGATTAGGAGAGAACCAGG - Intronic
1115566866 14:34631697-34631719 CTGTGTTTTAGGAGGAAAACTGG - Intergenic
1116120113 14:40712017-40712039 CTATTTATTGAGTGAAAACCAGG - Intergenic
1116825271 14:49667479-49667501 GTTTTTATTAGTAGAAAACTGGG - Intronic
1118577941 14:67263135-67263157 GTGTTTATTAGGAGCAAATAGGG + Intronic
1119825911 14:77656949-77656971 CTGTTAATTTTGAGAATACCTGG - Intergenic
1121262063 14:92573580-92573602 CTGTTTAGTAGCAGAAACTCAGG + Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123673767 15:22688193-22688215 CTATTGATTAGGAGAAGGCCAGG - Intergenic
1124081935 15:26507300-26507322 AGGTTTATTAGAAGAAAACAAGG + Intergenic
1124325770 15:28761184-28761206 CTATTGATTAGGAGAAGGCCAGG - Intergenic
1126548774 15:49903945-49903967 CTGTTTAAAAGAAGAAAATCTGG + Intronic
1126812217 15:52418619-52418641 ATGATCATTAGGAGAAAACCAGG + Intronic
1130100672 15:80891442-80891464 CTTTTTGTTAGAAGAAAACTAGG - Intronic
1139120370 16:64009165-64009187 CTTTTTATAAGAAGAGAACCAGG + Intergenic
1140112673 16:72017137-72017159 TTATTTATTAGGAGGAAACGTGG + Intronic
1140525422 16:75618889-75618911 CTGTTTATTAGTAGTATTCCTGG + Intronic
1141478504 16:84290440-84290462 ATGTTTATTAGCAGAGAACTGGG - Intergenic
1142056867 16:88003247-88003269 CTTTATTTTAGGAGAAAACCTGG + Intronic
1143855243 17:9843448-9843470 CAGTTTCTTAGGAGAAAACCTGG + Intronic
1143931626 17:10435091-10435113 CTAGTTTTTAGGAGAGAACCAGG - Intergenic
1145957629 17:28865513-28865535 CTGTTTATCAGGAGCCAACACGG + Intergenic
1147029961 17:37625291-37625313 CTGTTTATAAGAAGAAAGCAAGG - Intronic
1151923865 17:77178993-77179015 CTGTTTCCTAAGAGAAAACGTGG + Intronic
1156909622 18:42395198-42395220 ATGTTTTTTAAGAGAAAACATGG + Intergenic
1160145679 18:76362201-76362223 CTGTTTATTATAAGAAAATATGG + Exonic
1161498594 19:4600705-4600727 CTGTTTATGTGCAGAAAACAGGG - Intergenic
1164199147 19:23002630-23002652 ATTTTTAATAGGAGAAAACAGGG + Intronic
1164239852 19:23376190-23376212 CTATTTCTATGGAGAAAACCTGG - Intronic
1165753804 19:38279621-38279643 CTCTTTATTAAGAGAAAACTTGG - Intronic
1168474700 19:56667457-56667479 CTGTTTAGAGAGAGAAAACCAGG - Intronic
927557317 2:24044720-24044742 CTTTTTATTAGGGTAAAACAAGG + Intronic
932982568 2:76687400-76687422 TTGTTTATTAGCAGAAAACAAGG + Intergenic
933138266 2:78762292-78762314 CTGATGATAAGGAGAAAAACTGG - Intergenic
933264862 2:80171012-80171034 TTGTTGATTAGCAGAAGACCTGG + Intronic
934510802 2:94940470-94940492 CAGTTTATTCTGAGAAAAGCAGG + Intergenic
934677772 2:96261806-96261828 CTGTTTAGGAGGAAAAAAGCAGG + Intronic
935650586 2:105378546-105378568 TTGTTTCTTAGGACAAAACCTGG - Intronic
936001753 2:108838433-108838455 CTGTTTATAAGAGTAAAACCTGG - Intronic
936849991 2:116884344-116884366 ATGATTATAAGGAGAAAACAAGG - Intergenic
937334718 2:121055057-121055079 CTGTTTATGATGAGTAACCCAGG + Intergenic
937527758 2:122791613-122791635 CCTTTTATGAGGTGAAAACCTGG - Intergenic
939993070 2:148894571-148894593 CTGGTTATAAGGAAAACACCAGG - Intronic
940902151 2:159135538-159135560 CTGCTTATTATCAGAAAATCCGG - Intronic
941305723 2:163863451-163863473 CTGTGTAATTGGAGAAATCCTGG - Intergenic
942705899 2:178771656-178771678 CTGATAATTAGGAGAAATACTGG + Intronic
944319110 2:198315541-198315563 CTGTTGGTGAGGAGAAAAACTGG + Intronic
947620006 2:231583837-231583859 CTGTTTATTGGGGGAAAGCCTGG - Intergenic
947907299 2:233774689-233774711 CAGTTTGATAGGAGAAAAGCAGG + Intergenic
1169863415 20:10174560-10174582 CAGTTATTTAGGAGAAAACATGG + Intergenic
1169919949 20:10724625-10724647 CTGTTTCTGAGCAGAAAACAAGG + Intergenic
1172117228 20:32580322-32580344 CTGATAATTCAGAGAAAACCAGG + Intronic
1179299334 21:40092217-40092239 CTGTAAATGAGGAGAAATCCAGG + Intronic
1182973604 22:34601144-34601166 CTTTTTATTAGGGAAATACCTGG + Intergenic
949583996 3:5419413-5419435 CTGTAGATTAGAAGAAAACTAGG + Intergenic
949848229 3:8393815-8393837 CTGTATATTGGGAGAAAAACGGG - Intergenic
950217881 3:11172360-11172382 CTGCTTAGTAGGAGAAAGCAGGG - Intronic
953484652 3:43284363-43284385 TTGTTTATTGGAAGGAAACCAGG - Intergenic
954093817 3:48306837-48306859 ATGATTCTTAGCAGAAAACCTGG - Exonic
955125934 3:56112694-56112716 ACATATATTAGGAGAAAACCAGG + Intronic
957115254 3:76015703-76015725 CTGTGCATTGGAAGAAAACCAGG + Intronic
959246935 3:103882459-103882481 CTGTTTATTATTAAGAAACCTGG - Intergenic
960243456 3:115372990-115373012 CTGTTTTTTTGGGGAAACCCGGG + Intergenic
960713793 3:120556560-120556582 CTATTTAATAGAAGAGAACCTGG + Intergenic
961465312 3:127077694-127077716 CTGTCTTTTAGCAGAAACCCTGG - Intergenic
962247476 3:133808226-133808248 CTGCTTCTGAGGAGAAAACTAGG - Intronic
964716403 3:159727232-159727254 GTGTTGATTAGGAAAAAACTCGG - Intronic
967131110 3:186471537-186471559 CTGTTTATTTGAAGAATTCCAGG - Intergenic
967332875 3:188309325-188309347 CTGTATATTAGAAGAAACGCAGG - Intronic
967800228 3:193650034-193650056 CTGTTTATGGGGAGAAAATGTGG + Intronic
970344911 4:15144006-15144028 CTGTTAATTAGAAGCTAACCTGG + Intergenic
971332788 4:25696138-25696160 CTGTTTATTAGGAAAACAAGAGG - Intergenic
972168221 4:36312935-36312957 CTGTTTAATTGCAGTAAACCAGG + Intronic
974712312 4:65614665-65614687 CTGTTTATTAGGAGAAAACCTGG + Intronic
974811067 4:66946724-66946746 CTGTTCAGTAGAAGAAAACTAGG + Intergenic
975956860 4:79851098-79851120 TTGTTTATTCAAAGAAAACCTGG - Intergenic
977378491 4:96238641-96238663 CTTCTTATTAGGAGTAAACATGG + Intergenic
978509174 4:109496907-109496929 ATTTTTATGATGAGAAAACCAGG + Intronic
979325297 4:119372314-119372336 CTGTCTTCTAGGAGAATACCAGG + Intergenic
979712021 4:123790958-123790980 CTTTTTATTAGTAGGAAACATGG - Intergenic
982470011 4:155776725-155776747 TTGTTTATTAAGAAAAAAGCAGG + Intronic
983243201 4:165257335-165257357 CTGTCTTCTAGGAGAATACCAGG + Intronic
985883789 5:2660260-2660282 ATGTCTATTAGGAAACAACCTGG + Intergenic
986700393 5:10401984-10402006 TTGTTTAATATGGGAAAACCGGG + Intronic
987889335 5:23855845-23855867 CATTTTATTAGGACAAAACCTGG - Intergenic
990026836 5:51202496-51202518 CTGTTTATGAGGACAAAACTGGG - Intergenic
992196242 5:74341905-74341927 CTGCTTTCTAGGAGAGAACCAGG + Intergenic
993496399 5:88614693-88614715 GAGTTTATTAGGTGAAAAACAGG + Intergenic
994880321 5:105484289-105484311 TTCTTTATTGGTAGAAAACCAGG - Intergenic
995319254 5:110813486-110813508 CAGTTTTTTCGGAGAGAACCAGG - Intergenic
996097874 5:119418112-119418134 ATGTTAATTAGGAGTAAAACTGG - Intergenic
996762001 5:126995728-126995750 TTGTTTATTGGGAGAAAAACAGG - Intronic
998612869 5:143708258-143708280 CTGATTAAAAGGAGAAAACCAGG + Intergenic
1000260397 5:159582611-159582633 ATCTTTATTAAGAGAAAAACAGG - Intergenic
1000607243 5:163338277-163338299 CTGATGAGTAGGAGAAAAACTGG - Intergenic
1003361751 6:5433150-5433172 CTGTTAATTAACAGAAACCCTGG - Intronic
1003904376 6:10685563-10685585 CTGCATATTAGGAGACAAGCTGG + Intronic
1004948501 6:20642156-20642178 ATGTGTATTAGAAGAAAACATGG + Intronic
1007837564 6:44685764-44685786 CTGCTTATTAACAGAAAATCAGG + Intergenic
1008136955 6:47788142-47788164 CTGTTTATTTTCACAAAACCAGG - Intronic
1008310021 6:49956461-49956483 CAATATATTAGGAGACAACCAGG - Intergenic
1011478322 6:87769426-87769448 CTCTTTAATATGAGAAAATCAGG - Intergenic
1015403158 6:132809604-132809626 ATGTTTATTAAGTGAAAACAAGG - Intergenic
1015952520 6:138567616-138567638 TATTTTATTAGGAGAAAAACTGG + Intronic
1021711695 7:23422303-23422325 TTGTTTATTAAGAGTAATCCAGG + Intronic
1022849238 7:34243323-34243345 CCGTGCATTTGGAGAAAACCTGG + Intergenic
1025873058 7:65452983-65453005 CTGTTTATAAAGGGGAAACCTGG - Intergenic
1027608854 7:80334171-80334193 CTGATTATTAGGGGAAAATAGGG + Intergenic
1028300821 7:89197618-89197640 ATTTTAATTATGAGAAAACCAGG + Intronic
1028591600 7:92502137-92502159 ATGTATATTTGGAGAAAATCAGG + Intronic
1030110932 7:106026392-106026414 TTGTTTCTGATGAGAAAACCTGG - Intronic
1033303143 7:140204116-140204138 TTGTTTATGAGGAAACAACCAGG - Intergenic
1034281137 7:149855320-149855342 CTGTGTAGTAGTAGAAAATCTGG + Intronic
1034861545 7:154599386-154599408 CTTTTTATATGGAGAAAACGTGG + Intronic
1036660879 8:10707739-10707761 CTGTTTTTGAGGAGAAACCTAGG + Intronic
1038437445 8:27545829-27545851 CTGTGTATAGGGAGAAAGCCAGG + Intergenic
1039068387 8:33629127-33629149 CTGTTTAGTATGAGAAAAACAGG - Intergenic
1040524400 8:48206810-48206832 CTGTTTCTTAGCAGAAATACTGG + Intergenic
1041313479 8:56539237-56539259 CTTTTTATTATGAGAACGCCAGG - Intergenic
1044577059 8:93780961-93780983 CAGTTTTAAAGGAGAAAACCAGG + Exonic
1045479318 8:102579663-102579685 CTGTTTATTAGAAGTGAATCAGG - Intergenic
1046656583 8:116901227-116901249 ATGTTTATTAGCAGTAATCCTGG + Intergenic
1046919641 8:119714730-119714752 CTGTTTATTAAAAGAAAAAAAGG - Intergenic
1047984996 8:130223548-130223570 CAGTTTATAAACAGAAAACCTGG - Intronic
1051901628 9:22049155-22049177 CTGCTTTCTAGAAGAAAACCGGG + Intergenic
1052661551 9:31439408-31439430 CTGTCTATAAGGAGAAAAGTGGG - Intergenic
1059025261 9:110620969-110620991 CTGTTTATTAAGAAACAAGCTGG - Intergenic
1059704751 9:116812165-116812187 CAGGTTATAAGGAGCAAACCAGG - Intronic
1062689238 9:137832961-137832983 CTGTTTCTTTGGGGTAAACCAGG + Intronic
1187264210 X:17716534-17716556 CTGATTTTTAGGAGAGAACCAGG + Intronic
1189743093 X:44141964-44141986 CACTTTTCTAGGAGAAAACCGGG + Intergenic
1190633495 X:52411728-52411750 CTGACTGTTAGGAGAAAAACGGG + Intergenic
1190729862 X:53218509-53218531 CGGTTCATTGGGAGAAACCCTGG - Intronic
1193197499 X:78650918-78650940 CTGATTATTAGAAGAAAAGCTGG - Intergenic
1193243779 X:79205232-79205254 CAGTTTCCTTGGAGAAAACCAGG - Intergenic
1196907811 X:120455119-120455141 CTGTATACTAGGATAATACCTGG + Intronic
1198160110 X:133999763-133999785 CTGTTTATAAAGGGGAAACCTGG + Intergenic
1199558139 X:149131631-149131653 TTTTTTTTTAAGAGAAAACCTGG + Intergenic