ID: 974715451

View in Genome Browser
Species Human (GRCh38)
Location 4:65664433-65664455
Sequence TTGTAAACACAGATTAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 394}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974715451_974715454 28 Left 974715451 4:65664433-65664455 CCCATTTTAATCTGTGTTTACAA 0: 1
1: 0
2: 0
3: 21
4: 394
Right 974715454 4:65664484-65664506 CTACCTTTATGTACACCCATAGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974715451 Original CRISPR TTGTAAACACAGATTAAAAT GGG (reversed) Intronic
900434032 1:2618773-2618795 ATGTAAATACATATTCAAATTGG - Intronic
900964721 1:5949981-5950003 TTTTAAACACAGAAGAAAAATGG + Intronic
901037562 1:6345463-6345485 CTGTAAACACAGATAATAAATGG + Intronic
903632435 1:24786264-24786286 TTCTAAAGACTGATTAAACTAGG + Intronic
904683756 1:32246676-32246698 TTGAAAACAAAGTTTAAAAAAGG + Intergenic
905495892 1:38385744-38385766 TTCTAAACATAGATTTAAAAAGG + Intergenic
906031808 1:42726913-42726935 TTGTAAACATTGCTTAAAACAGG + Intergenic
906969838 1:50500304-50500326 TTGTAAAGACAGAAAAAAAATGG + Intronic
907070574 1:51530970-51530992 TTGTAAAAAAAGAAAAAAATAGG + Intergenic
908716394 1:67074702-67074724 TTGTGAACACATATTGTAATAGG - Intergenic
908965692 1:69759575-69759597 TTGAAACTACAGATTATAATTGG - Intronic
908979523 1:69938136-69938158 TTTTAAACACAGTGTAAAGTTGG + Intronic
909163851 1:72191703-72191725 TTGTAATCACAGTTTAAAGGTGG - Intronic
909238566 1:73182558-73182580 TAGAAAACACAGTTTAAAAATGG - Intergenic
909795028 1:79723307-79723329 TTGAAAACAAAGAATAAAGTGGG + Intergenic
914328535 1:146644679-146644701 TTGTAAACAAAGGAAAAAATAGG - Intergenic
918938713 1:190960800-190960822 TTGCAAAAACAGAATCAAATTGG - Intergenic
919272399 1:195364782-195364804 TTTTAAATACAGAATATAATTGG + Intergenic
919674427 1:200367324-200367346 TTGGAAATACAGATTGAAAGAGG + Intergenic
920042219 1:203107851-203107873 TTGAAACTACAGATTAATATAGG + Intronic
920605424 1:207378473-207378495 TTGTTAACAAAAATTAAAAATGG - Intergenic
920760916 1:208783073-208783095 CTGTACACACAGAGTAAAAGAGG - Intergenic
922243222 1:223770553-223770575 TTCTACAGACAGATTAAACTAGG - Intronic
922400789 1:225252554-225252576 TTGTAAACATAGATCTAAACTGG - Intronic
923721419 1:236470168-236470190 TTGTATACACAGATTAAATGCGG - Intronic
923830452 1:237549943-237549965 TTTTAACCACAGTTTAACATTGG + Intronic
924324262 1:242879480-242879502 TTGTAAACATAAGTAAAAATTGG - Intergenic
924402261 1:243697763-243697785 TTTTAAGCAAAGATTAAATTTGG - Intronic
924664373 1:246055519-246055541 CTGAAAGCACAGATTCAAATAGG + Intronic
1064336922 10:14451815-14451837 GTGTGAAAACAGATTAATATAGG + Intronic
1064435659 10:15308973-15308995 ATGGAAATACTGATTAAAATAGG - Intronic
1065182385 10:23139694-23139716 TTATGACCTCAGATTAAAATGGG + Intergenic
1065570704 10:27068748-27068770 ATGTAAACATAGATAAACATGGG + Intronic
1066223633 10:33360209-33360231 TTTTAAACCCGTATTAAAATGGG + Intergenic
1067945634 10:50686532-50686554 ATGTAGACACAGATTTACATTGG + Intergenic
1070047772 10:72856198-72856220 TTGTCACCACAGATTATATTAGG - Intronic
1070585722 10:77764402-77764424 TTGTTAACACAGAATAAAACAGG + Intergenic
1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG + Intronic
1070880937 10:79851526-79851548 ATGTAGACACAGATTTACATTGG + Intergenic
1071222366 10:83483871-83483893 TTGTAAAAAAAGATCAAATTTGG - Intergenic
1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG + Intronic
1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG + Intronic
1073947688 10:108769872-108769894 TTGTTAATACAAATCAAAATGGG - Intergenic
1076025555 10:127109280-127109302 ACATAAACACAAATTAAAATGGG - Intronic
1078462241 11:11522872-11522894 CTGTAAACCCAGATTTGAATAGG - Intronic
1080172506 11:29322179-29322201 TTGGAAACAAGGATTCAAATTGG + Intergenic
1081322649 11:41709807-41709829 TTATACACACACATAAAAATCGG - Intergenic
1081406068 11:42699668-42699690 TTAAAAACACAGCTTAAACTGGG - Intergenic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1082982114 11:59133198-59133220 GTGTAAAAACAGATTAATACAGG - Intergenic
1084682378 11:70673878-70673900 TTGTAAAAACAGTTAAAAGTAGG + Intronic
1086162433 11:83737571-83737593 TTATAAACACAGATTGGAAAAGG + Intronic
1088113151 11:106285109-106285131 TTCCAAACACATATTAATATGGG - Intergenic
1088324058 11:108584100-108584122 TTAAAAACAAAGAATAAAATCGG + Intronic
1088912321 11:114200974-114200996 CTGTAAACTCTGAATAAAATAGG - Intronic
1089489779 11:118875298-118875320 TTGTAAACACTGCTTAGTATGGG - Intergenic
1090507865 11:127338726-127338748 TTATAAACACTGATTAAATAAGG + Intergenic
1090563284 11:127957515-127957537 ATGTAAACATATATAAAAATAGG - Intergenic
1091444781 12:538253-538275 TAGTAAACAGTGATCAAAATTGG + Intronic
1092993986 12:13930546-13930568 TTTTAAACACAGATTAATGGTGG - Intronic
1093367005 12:18314853-18314875 ATGTCAACACAGCTTAAATTAGG + Intronic
1093412105 12:18879333-18879355 TTGTAAAAAGAGAATAAATTTGG - Intergenic
1093726107 12:22510469-22510491 TTTTAAAAAGAGATTTAAATAGG + Intronic
1093864258 12:24205927-24205949 TTGCAAACACAGATTAGAGCAGG - Intergenic
1093957956 12:25243776-25243798 TTTGCAATACAGATTAAAATGGG + Intronic
1094403630 12:30090439-30090461 ATGTGAACACAGCTTAAAGTAGG - Intergenic
1094426262 12:30320328-30320350 AGATAAACACAGATGAAAATAGG + Intergenic
1098125729 12:67290917-67290939 TTGCACACACAGTTTACAATAGG - Intronic
1099132170 12:78847685-78847707 TTGTCAACTTACATTAAAATTGG + Intergenic
1099552301 12:84062775-84062797 TTGGAAAAACAGATTAAATTTGG - Intergenic
1099967355 12:89463267-89463289 TTGTAAGCAGGGATTATAATTGG - Intronic
1102378605 12:112444263-112444285 TTGAAAACACGGATTCAAATTGG - Intronic
1104483868 12:129132406-129132428 TTGTAAACAAACAAAAAAATAGG + Intronic
1105774312 13:23642891-23642913 CTGTGAACACACATTAAAGTTGG - Intronic
1106998102 13:35511270-35511292 TTGTAAGCAGAGAATAAAATAGG - Intronic
1107498002 13:40947542-40947564 TTGTAAACCCAGGTTAAGACAGG - Intronic
1108583874 13:51851049-51851071 TTTTAAACAAATCTTAAAATTGG - Intergenic
1109135061 13:58638189-58638211 TTGGAAACAAAAATTCAAATGGG + Intergenic
1109514119 13:63418927-63418949 TTATAGACAAAGACTAAAATTGG - Intergenic
1109664596 13:65516710-65516732 CAGTAAACACAGATTACAAGGGG - Intergenic
1110454497 13:75675422-75675444 TTGTAAACAAAGTTTAAGCTAGG + Intronic
1110641082 13:77824840-77824862 TTGAAAACACTCAGTAAAATAGG + Intergenic
1111763128 13:92491426-92491448 TTTTATACACATATTAAGATGGG + Intronic
1112489475 13:99848757-99848779 GTGAAAACACAGAGTAAAAGTGG + Intronic
1116159528 14:41251438-41251460 TTGGGAATACAGAGTAAAATAGG - Intergenic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1117539968 14:56737444-56737466 TTATAAACATTGATAAAAATGGG + Intergenic
1117708403 14:58497815-58497837 TTGTTCATACAGCTTAAAATGGG - Intronic
1120054864 14:79911873-79911895 TGGTAAATTCAGATTATAATTGG + Intergenic
1120657801 14:87216433-87216455 TTGTAAACACATATTTACAGTGG + Intergenic
1120916384 14:89714115-89714137 TTGTAAACACTGTGTAAAAGGGG - Intergenic
1122010378 14:98741509-98741531 TTGTAAATAGAGTTTAAAAAAGG - Intergenic
1124048508 15:26173726-26173748 TTGTATACACAGATTCTAAATGG - Intergenic
1124059613 15:26277784-26277806 TTGTTAACTCAGTTTTAAATAGG + Intergenic
1124869717 15:33528513-33528535 ATGGAAACACCTATTAAAATAGG - Intronic
1126980422 15:54236623-54236645 GTGCAAACACAGACCAAAATAGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127434790 15:58946456-58946478 TTTAAAACACAGATAACAATAGG + Intronic
1128161688 15:65426906-65426928 TTTTAAAAACACATTAAAACAGG - Intergenic
1129565532 15:76618777-76618799 TTGTAAACATTGCTTAAAACAGG - Intronic
1130337182 15:82966379-82966401 TTATAAAAACAGAATAAAAGGGG + Intronic
1131482564 15:92794568-92794590 TTGTAAACAGGGAGAAAAATAGG - Intronic
1133517309 16:6521879-6521901 ACCCAAACACAGATTAAAATGGG - Intronic
1134912123 16:18036973-18036995 TTATAAAGACAGATTGAAAGAGG + Intergenic
1136901515 16:34044063-34044085 TTGGAAAAAAAGATTATAATTGG - Intergenic
1137939473 16:52669496-52669518 TCGTAACGACACATTAAAATTGG + Intergenic
1137990573 16:53150446-53150468 TTGTTAACAGAAATTTAAATGGG + Intronic
1138144992 16:54600736-54600758 TTGTAAACACAACCTAAAAATGG - Intergenic
1138257588 16:55580258-55580280 TTGAAAAAACAGGATAAAATGGG + Intronic
1140005029 16:71066263-71066285 TTGTAAACAAAGGAAAAAATAGG + Intronic
1140294745 16:73697739-73697761 TTGTGACCACAGAATAAAAGTGG - Intergenic
1140579644 16:76214603-76214625 ATGTAAGTACAGATGAAAATGGG - Intergenic
1140653257 16:77112024-77112046 TTATAAATACAGATATAAATCGG - Intergenic
1140731986 16:77864626-77864648 TTCAAATCACAGATTAAGATGGG + Intronic
1142911406 17:3096193-3096215 TAGAAAACACAAAGTAAAATGGG + Intergenic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1145094329 17:20011103-20011125 TTATGAACACAGATAAAAATGGG - Intronic
1145192599 17:20857610-20857632 ATGTAAAAACAGAATAATATAGG + Intronic
1145403122 17:22560680-22560702 ATGTAAAAACAGAATAATATAGG + Intergenic
1145789166 17:27614302-27614324 TTGTAAAGAGAGGTTAAAACTGG - Intronic
1146014253 17:29219781-29219803 TTGTATCCACGGATGAAAATAGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146795520 17:35777593-35777615 TAGTCAACACAAATTAAAAGTGG + Intronic
1148509014 17:48153152-48153174 TTTTAAAAAGAGAATAAAATTGG - Intronic
1148581728 17:48748487-48748509 TTTTAAAGATAGATTAAAATCGG - Intergenic
1150856865 17:68761411-68761433 TTTAAAAAACAGATTCAAATAGG - Intergenic
1151233028 17:72698419-72698441 TTGTAAATATACATAAAAATAGG - Intronic
1151527366 17:74680145-74680167 CTGTAAAATGAGATTAAAATAGG - Intronic
1153248519 18:3097056-3097078 TTTTGAAAACAGCTTAAAATAGG + Intronic
1153468036 18:5411665-5411687 TTGAAAACAAAAATGAAAATGGG + Intronic
1154132340 18:11748066-11748088 TTCTAAACACAAATGAGAATCGG + Intronic
1155384008 18:25257268-25257290 TTGAAAAAATAGATTGAAATGGG - Intronic
1157958308 18:52124016-52124038 TTGAAGACACAGATGAAAGTAGG + Intergenic
1158099617 18:53815732-53815754 CTGTAAATACAGATTTAAAATGG - Intergenic
1158102847 18:53850009-53850031 TTGTAAACTGAGATGAAACTAGG + Intergenic
1158674440 18:59505640-59505662 TTATAAAGACATGTTAAAATTGG + Intronic
1158846113 18:61444472-61444494 TTGTAAAAACAGACTGAAGTTGG + Intronic
1159644000 18:70895991-70896013 TTGTAAGCAAAGATTTAAAGAGG - Intergenic
1159687430 18:71440236-71440258 TTGAAAATAAAGATTAAAATTGG + Intergenic
1159790557 18:72774271-72774293 TTCTAAACAAAGAATAAGATTGG + Intronic
1160189156 18:76700721-76700743 CTCAAAACACAGATTAAAACTGG - Intergenic
1161426213 19:4204704-4204726 TCGGAAACTCAGAATAAAATAGG + Intronic
1162347151 19:10125711-10125733 TTGTAAAAAAAAATAAAAATAGG + Intergenic
1162471943 19:10877409-10877431 ATACAAACACAGATAAAAATAGG - Intronic
1163780082 19:19241759-19241781 TTGAAAACAGAGATTCAAAGTGG + Intronic
1165126914 19:33604643-33604665 TTCTAAACACAGCCCAAAATTGG + Intergenic
926973374 2:18488895-18488917 TTTTAAAAACAGATTAAACAGGG - Intergenic
928216277 2:29364050-29364072 CTATAAACACAGATTCAAAATGG + Intronic
928678233 2:33671508-33671530 TGGTAGACACAGAGTAACATAGG + Intergenic
928776700 2:34773229-34773251 ATGCAAACACAGACTAAAATAGG + Intergenic
929219443 2:39448550-39448572 TTCTCAAAACAGATTAAAACTGG + Intergenic
929431528 2:41891399-41891421 AAGTAAAAACAGTTTAAAATTGG + Intergenic
929541449 2:42825921-42825943 ATGTAAAAACTGATTAAAAATGG + Intergenic
930186187 2:48414481-48414503 CTATAAACACAGATTAATACAGG - Intergenic
931134786 2:59385895-59385917 GTGTATACACAAAATAAAATAGG - Intergenic
931536457 2:63282596-63282618 TATAAAACATAGATTAAAATTGG + Intronic
931865150 2:66401563-66401585 TTGAATACACAGAAAAAAATTGG + Intergenic
932242056 2:70164907-70164929 TAGGGAACACACATTAAAATTGG + Intronic
932957228 2:76366601-76366623 TTGGAGACACTGATAAAAATAGG - Intergenic
933162401 2:79039984-79040006 TTTTATACACAGATTAGGATTGG - Intergenic
935442619 2:103119298-103119320 ATTTAAACACAGGTTAATATAGG - Intergenic
935902621 2:107808726-107808748 ATGTAAACACAGACTCAAAAGGG - Intergenic
937187917 2:120063430-120063452 TTGGAAACACACTTTAAAAAGGG - Intronic
937380189 2:121369560-121369582 TTGTTAACAGTGATTAGAATTGG - Intronic
937565806 2:123287008-123287030 TTGTAAACACAGAGAAACACAGG + Intergenic
937769880 2:125708107-125708129 TTGTAAAAAGATATTAAAAATGG - Intergenic
939338904 2:140867990-140868012 ATGTATACATATATTAAAATTGG - Intronic
940328292 2:152448534-152448556 TTGGAAAGACAGATTAAATGTGG + Intronic
940464966 2:154015570-154015592 TTAAAAACTCAGAATAAAATGGG - Intronic
941351823 2:164447452-164447474 TGTTAAACCAAGATTAAAATAGG - Intergenic
942373743 2:175314109-175314131 TTGAAAAGACAGATCAAATTTGG - Intergenic
942384209 2:175424176-175424198 TTGTAAACATATTTTAAAAAGGG - Intergenic
942396828 2:175558432-175558454 GTGGAAACATAGATTAAAAGTGG - Intergenic
942907514 2:181201614-181201636 TTAATAACACAGATGAAAATGGG + Intergenic
943814006 2:192228206-192228228 TTGTAAAAACAGAAGAAATTTGG + Intergenic
943828490 2:192427182-192427204 TTGTACCCACAGAATAAAAAAGG + Intergenic
943848162 2:192678432-192678454 TTGTAATTACAGATTACATTAGG - Intergenic
944004971 2:194893381-194893403 TTGAAAACCCAGAAAAAAATAGG - Intergenic
945406939 2:209460121-209460143 TTGTACTCACAAATTAAAACAGG - Intronic
948173142 2:235922505-235922527 TTGTAAAGACAGACCAAAATTGG + Intronic
948186487 2:236025587-236025609 GTGTAAACACGGATTAAACACGG + Intronic
1172541584 20:35721581-35721603 GTGACAACATAGATTAAAATAGG - Intronic
1173135884 20:40438464-40438486 TGGGGAACACAGATTAAAATGGG + Intergenic
1173359516 20:42329384-42329406 TTGTAAAGCTATATTAAAATGGG + Intronic
1173989661 20:47292096-47292118 TTGAAAACCAAGAATAAAATTGG - Intronic
1174114433 20:48217278-48217300 TTCGAAACACAGATCAAAGTGGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175198055 20:57259401-57259423 TTGGAAACACAGTTTATACTTGG + Intronic
1177071053 21:16508750-16508772 TTGTAATCAAAGAACAAAATAGG + Intergenic
1177370138 21:20192227-20192249 TTGTAAACAAAAAGTAAGATAGG + Intergenic
1177893898 21:26839108-26839130 TTGAAAACACATATTGAACTAGG - Intronic
1178172516 21:30057587-30057609 TGTTAACCACAGATTAAAACTGG + Intergenic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1180670968 22:17552794-17552816 TTTTAAACAAAAATAAAAATTGG - Intronic
1180833975 22:18920612-18920634 TTGAAACCACAGCTTAAACTGGG - Intronic
1183773005 22:39943183-39943205 TTGGAAACCCAGATTATAAGTGG - Intronic
1203284061 22_KI270734v1_random:145910-145932 TTGAAACCACAGCTTAAACTGGG - Intergenic
949856294 3:8464480-8464502 TTGTAAACACTTACAAAAATCGG - Intergenic
950802414 3:15564490-15564512 TTTTAAAAAGAGATTAAAACGGG + Intronic
950909407 3:16573113-16573135 TTGTTAACAAAGATACAAATTGG - Intergenic
951319118 3:21223804-21223826 GTGTAAAAACAGAGTAAAACTGG + Intergenic
953048696 3:39320444-39320466 TTTTAAAAAGAGAATAAAATGGG - Intergenic
956226154 3:66961468-66961490 ATGTATACACAGACTTAAATTGG - Intergenic
957809979 3:85209020-85209042 TTGTAAACACAGACAAGAAATGG + Intronic
957837468 3:85616281-85616303 TTGAAAACTCAGAATAAATTTGG - Intronic
958004567 3:87794345-87794367 TTTGAAACAAAGATTAGAATGGG - Intergenic
958471077 3:94520971-94520993 TCATGAACACAGAGTAAAATAGG - Intergenic
958830011 3:99075047-99075069 TAGTAAATACAGAATCAAATGGG - Intergenic
958939415 3:100293608-100293630 TTACAAACACAGATTAGAAGAGG - Intronic
958972620 3:100629125-100629147 TTGAAAAACCAGATGAAAATGGG - Intronic
959555249 3:107709943-107709965 TTGTAAGCACAGATTTAACATGG + Intronic
959854737 3:111138380-111138402 TTTTAAAAACAGATGAAAGTTGG - Intronic
962798461 3:138869039-138869061 GTTTAAAAACAGATTAAAATTGG - Intergenic
963287819 3:143453170-143453192 TTGAATACACAAATTAACATAGG + Intronic
963882977 3:150548627-150548649 TTGTATGCACAGTTCAAAATAGG - Intronic
964892197 3:161550880-161550902 TTGTAAAGTTAGATTAGAATTGG - Intergenic
965153773 3:165017894-165017916 TAGTATACATAGATGAAAATGGG - Intronic
965978443 3:174656020-174656042 TTTTAAACAAATATTAAACTCGG - Intronic
966983267 3:185156724-185156746 TTGTAAACAAAAATTAAAGAAGG + Intergenic
967086898 3:186103570-186103592 TTGTCAACACAGAACAAAGTTGG + Intronic
968396748 4:245585-245607 TTCAAAATACAGATCAAAATGGG + Intergenic
968898769 4:3420790-3420812 TTGTAAACACAGGTTTCCATGGG - Intronic
969906403 4:10400684-10400706 GTGTAAAGACAGATCAAAACAGG - Intergenic
971875571 4:32303853-32303875 TTAGAAACAGAAATTAAAATTGG + Intergenic
971928498 4:33047225-33047247 ATGTAAACTCAGGTTAAAAATGG + Intergenic
972467814 4:39374144-39374166 AAATAAACACAGATTAAAGTAGG - Intergenic
973084203 4:46033866-46033888 TTGTATACTCTGAATAAAATAGG - Intergenic
974146031 4:57948643-57948665 TTCTAAAGACAGATTATAAATGG - Intergenic
974203924 4:58674915-58674937 TTGTAAATACAAATTATGATAGG - Intergenic
974715451 4:65664433-65664455 TTGTAAACACAGATTAAAATGGG - Intronic
975139361 4:70903530-70903552 TTCTAAACACAGACTAAACATGG - Intronic
975976873 4:80108422-80108444 ATATAAGCACAGATAAAAATGGG + Intronic
976756543 4:88504378-88504400 TTGGAAATACAGATTATGATTGG + Exonic
976856217 4:89608552-89608574 GTGTAAATAGATATTAAAATGGG + Intergenic
977172285 4:93778278-93778300 TTGTAAACAGATATTAATAGAGG - Intergenic
977188768 4:93973518-93973540 TGATAAAAACAAATTAAAATAGG + Intergenic
977428815 4:96904997-96905019 TTGAAACTACAGATTAAACTGGG - Intergenic
977438600 4:97034145-97034167 TTTTAAATAAAGATGAAAATTGG + Intergenic
977506453 4:97909325-97909347 TTTTAATAACAGATTAAATTTGG - Intronic
977628518 4:99215857-99215879 TTACAAGTACAGATTAAAATAGG + Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
978894421 4:113870239-113870261 TTGTGAAAACAGACTAACATAGG + Intergenic
978933689 4:114349667-114349689 TAGAAAAAACAGATTAAAAATGG + Intergenic
979059035 4:116031161-116031183 TTGTAAATGCAGTTTATAATTGG - Intergenic
979387594 4:120087640-120087662 TTGGAAACACAGACTAGGATTGG - Intergenic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
980233052 4:130068526-130068548 TTGAAAACACATATAAAAACAGG - Intergenic
980679193 4:136134209-136134231 TTGTACATACATATGAAAATAGG + Intergenic
980711617 4:136576207-136576229 TTATAAATACAGGTAAAAATAGG - Intergenic
981685166 4:147446271-147446293 TGTTAATCACAGATGAAAATTGG - Intergenic
981838793 4:149086677-149086699 TTCTATACACATATTAGAATTGG + Intergenic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
982309814 4:153973178-153973200 TTTTCAACACATATTAAACTTGG + Intergenic
982591615 4:157320250-157320272 TTATAAGTACTGATTAAAATGGG + Intronic
983030652 4:162797641-162797663 TTATAAACAAATATGAAAATTGG + Intergenic
983420687 4:167511682-167511704 AAGTAAACAATGATTAAAATTGG - Intergenic
983738432 4:171093135-171093157 TGGTAAACACATTTTTAAATCGG + Intergenic
986056207 5:4139306-4139328 TTGTAAACAGAGTTTCAAAATGG + Intergenic
986534227 5:8769934-8769956 TTGTGAACAGAGATAATAATTGG + Intergenic
986677431 5:10198705-10198727 GTAGAAACACAGATGAAAATTGG - Intergenic
987043399 5:14084525-14084547 AAGTAAACACACATAAAAATGGG + Intergenic
987160671 5:15139014-15139036 TTGTTTTAACAGATTAAAATGGG + Intergenic
987213007 5:15703284-15703306 TTGTAAACTGAGGTTACAATGGG + Intronic
987418625 5:17692031-17692053 TTGAAGACACAGTTTAAAACCGG + Intergenic
987481996 5:18471459-18471481 TTGTAAGGAAAGATTGAAATTGG - Intergenic
987596252 5:20003425-20003447 TTGTAAACACAGACTTCAAATGG + Intronic
987813259 5:22867250-22867272 TTGTAGACACAGAACAAAGTTGG + Intergenic
988813526 5:34807984-34808006 TTTTACAAACAGAGTAAAATGGG - Intronic
989668268 5:43882539-43882561 TGGTAAACACACATGAAAAAGGG + Intergenic
989766759 5:45095150-45095172 TTGTAAACATTTATTCAAATAGG - Intergenic
989803133 5:45569659-45569681 TTGTAAAAACAGATAAAGACTGG - Intronic
990045768 5:51428880-51428902 TTGAAAACACAGATAAATAAAGG + Intergenic
990054573 5:51556121-51556143 TTGTAAAAACAGAATAAAGTGGG + Intergenic
990561875 5:56991653-56991675 TTAGAAACACAGATTGAAGTAGG - Intergenic
990767188 5:59197627-59197649 TTCTAACCACAAATAAAAATAGG - Intronic
991076901 5:62550421-62550443 TTGAAAACATAGGGTAAAATCGG - Exonic
991430908 5:66544146-66544168 TTGTAAAGAAAGATCAAAGTTGG - Intergenic
991567289 5:68018708-68018730 ATGGAAACACAGAGTAAAAGTGG + Intergenic
992973653 5:82088982-82089004 TTTTAAAGAAAGAATAAAATGGG + Intronic
993011308 5:82486351-82486373 TGGCAAAGACAGATGAAAATTGG + Intergenic
993190967 5:84680217-84680239 CTGAAAACACACAGTAAAATGGG - Intergenic
993243703 5:85424409-85424431 TTGAAGAGACAAATTAAAATGGG - Intergenic
993260381 5:85650408-85650430 TTTTAAACAAAGTTTAAGATAGG + Intergenic
993562298 5:89425222-89425244 TGATAAAGACAGATTCAAATAGG + Intergenic
994647327 5:102486342-102486364 TTGAAAACAAAGCTTAAAAATGG - Intronic
995326634 5:110897137-110897159 TTGTAACCACAGAAGTAAATGGG + Intergenic
996295179 5:121905726-121905748 TTGGCAAAACAGACTAAAATGGG + Intergenic
996466903 5:123813431-123813453 TTGTAACCACAGATTATGACTGG + Intergenic
997098672 5:130943133-130943155 TTCTAAACTCAAATAAAAATGGG - Intergenic
997489237 5:134259240-134259262 TTGGAAACATAAATTAAAACTGG + Intergenic
998007896 5:138669361-138669383 TTTTAAACAAAGATTAGGATTGG + Intronic
998069068 5:139182515-139182537 TTGTTACCACAGGTTACAATAGG - Intronic
998331772 5:141333998-141334020 AAGTTAACACACATTAAAATAGG - Intronic
998669626 5:144339212-144339234 TTGTAAAATGAGAATAAAATTGG - Intronic
998992628 5:147834952-147834974 TTCTAATCACAGATTAGGATTGG - Intergenic
999199832 5:149807987-149808009 TTTTAAACACTGATATAAATAGG - Intronic
999637501 5:153638074-153638096 TAGTATCCAGAGATTAAAATAGG + Intronic
1000197746 5:158976087-158976109 TTGTCAAGACAGAATGAAATTGG + Intronic
1000362572 5:160461595-160461617 TTGTAAATACAGGTAAAACTTGG + Intergenic
1002453941 5:179335517-179335539 TAATAAACACAGCTTAATATTGG + Intronic
1003731379 6:8828357-8828379 TTGCCAAGAGAGATTAAAATAGG - Intergenic
1003861045 6:10322023-10322045 TTGGAAGCACAGGTTAAAAAGGG - Intergenic
1003887650 6:10535701-10535723 TTTCAAACTCACATTAAAATAGG + Intronic
1004867091 6:19864351-19864373 TATTCAACATAGATTAAAATTGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1004996658 6:21199765-21199787 TTATAAAAACTGATTTAAATGGG + Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005226381 6:23647978-23648000 TTGTTCACACAGATTAAGATTGG + Intergenic
1005516811 6:26563060-26563082 TTGTAAACACACACAAAAATGGG - Intergenic
1005637137 6:27763021-27763043 TTTTAAACACATATGAAAATGGG - Intergenic
1006098926 6:31673587-31673609 AGGTAAACACAGATTAAAGAGGG + Intronic
1006203268 6:32316238-32316260 TTTTAAACACTAATTAAAAGAGG - Intronic
1006386688 6:33734915-33734937 CTGTAAACACAGGGCAAAATGGG - Intronic
1007866309 6:44973650-44973672 GTGTGAAAACAGATTAATATAGG - Intronic
1008542772 6:52559753-52559775 TTGTGAACATAGTTTAAAAATGG - Intronic
1010922471 6:81700800-81700822 TTGTAAATACACTTTAATATAGG + Intronic
1010942815 6:81939041-81939063 TAGTAAACACTGATTACACTTGG + Intergenic
1011839082 6:91473840-91473862 GTGTAAAAACAGTCTAAAATGGG - Intergenic
1011867714 6:91851310-91851332 CTGTAAAAAAAGATTAAAAGTGG - Intergenic
1013163454 6:107568515-107568537 TTCTACACACAGAATAAATTAGG + Intronic
1013334661 6:109143558-109143580 GTGTAGACACATATTAAAGTGGG - Intronic
1013927150 6:115486978-115487000 TAGAAAACAGAGATTAATATGGG - Intergenic
1015898503 6:138039908-138039930 TTGTAAACACTCATTAAGAGAGG - Intergenic
1016454646 6:144217762-144217784 TTGTAACCATTAATTAAAATAGG - Intergenic
1016494650 6:144646820-144646842 TTTTAAACACATTTTAAAATGGG + Intronic
1016571228 6:145515350-145515372 TTGTGAACACAGATCAGATTGGG + Intronic
1016580367 6:145622866-145622888 CTGTGAACAGAGATTATAATGGG + Intronic
1016663001 6:146602820-146602842 TTGTATGCACAGTTTACAATAGG - Intronic
1016928006 6:149372567-149372589 TTGTAAAGCCAGATTAACATAGG - Intronic
1016950516 6:149575048-149575070 TGGTAAACACACATGAATATTGG - Intronic
1020480393 7:8652949-8652971 TTGTTAACACAGAAAAATATAGG + Intronic
1021246402 7:18267966-18267988 ATGTAAAGAAAGAGTAAAATTGG - Intronic
1022225851 7:28362180-28362202 TTCTATACAGATATTAAAATAGG - Intronic
1022877297 7:34547734-34547756 TTGGAAATACATGTTAAAATGGG + Intergenic
1022890890 7:34697951-34697973 TTTTATAAACAAATTAAAATAGG - Intronic
1023782312 7:43668475-43668497 TTGTAAAAACAAATTATGATAGG - Intronic
1024714647 7:52062373-52062395 TTGCAAAAAAATATTAAAATTGG + Intergenic
1026520178 7:71110585-71110607 AAGTTATCACAGATTAAAATGGG + Intergenic
1027130905 7:75590505-75590527 TAGAAAACATAGAATAAAATGGG + Intronic
1027419298 7:78004299-78004321 TTGTTGACTCAGATTAAAAACGG + Intergenic
1027502433 7:78969831-78969853 GAGTAAACACTGATTAATATTGG - Intronic
1027924416 7:84442736-84442758 TTGGATCCAAAGATTAAAATGGG + Intronic
1028178900 7:87692880-87692902 TTTTAAACAAATATTAAATTTGG - Intronic
1028332584 7:89613182-89613204 TTGTAACCTGGGATTAAAATGGG - Intergenic
1031447969 7:121878070-121878092 CTTTAAACACAGAGAAAAATTGG - Intronic
1031515678 7:122695468-122695490 TAGTAAACCCAGAGTAAAAGGGG + Intronic
1033111812 7:138586257-138586279 TTATAAATACAGATTAACTTCGG - Exonic
1033389784 7:140915776-140915798 TTTTAAAAACAGATTAATTTTGG + Intronic
1034185166 7:149170394-149170416 TTGTAAACACATGTAAAGATAGG + Intronic
1034395208 7:150818338-150818360 TTGAAGACAAAGAATAAAATTGG + Intergenic
1034926096 7:155123347-155123369 TTGTGCACACAAATAAAAATTGG + Intergenic
1035816438 8:2546366-2546388 TTTTAAACATAGATTTAGATAGG + Intergenic
1037203765 8:16289522-16289544 TTGAAAAAACAGATTAAAGCAGG - Intronic
1038451469 8:27642024-27642046 AGTTAAACACAGATTTAAATGGG + Intronic
1038923104 8:32107931-32107953 GTGTAAACAGACATTAACATAGG - Intronic
1039655656 8:39402552-39402574 TTGTAAACCCACATTTATATAGG - Intergenic
1040762558 8:50867798-50867820 TTTTAAACATAGTTAAAAATCGG + Intergenic
1040844867 8:51826653-51826675 TTGTTAACAAAGATTGAAAACGG + Intronic
1041435009 8:57829464-57829486 AGGTAACCACAGTTTAAAATAGG + Intergenic
1041533602 8:58899931-58899953 TTGTTGAAACAGATCAAAATAGG - Intronic
1041629917 8:60075645-60075667 TTATAGAGACAGATTATAATGGG - Intergenic
1042223417 8:66495547-66495569 TTCTAAATACAAAATAAAATTGG - Intronic
1043115113 8:76241265-76241287 TTGTAACCACAGATGAAACATGG - Intergenic
1043627635 8:82283135-82283157 TTGTAACAATAGATTAAAACTGG + Intergenic
1044517113 8:93152377-93152399 TTGTGAACTCAGATTTAACTAGG + Intronic
1045264150 8:100604699-100604721 TTTTAAACTCAGGTTAAAAGAGG + Intronic
1045557896 8:103232484-103232506 TTGCAAAGACGGATGAAAATAGG + Intergenic
1045727237 8:105188265-105188287 TGGTAAACACAGAAAATAATTGG + Intronic
1045851416 8:106703337-106703359 TGGTAAACACTGAATTAAATGGG - Intronic
1046582392 8:116109584-116109606 TTGTATACACAGATATAATTAGG + Intergenic
1046689380 8:117266043-117266065 TTGTCAACACAGAGCAAAAAAGG - Intergenic
1046772514 8:118130217-118130239 TTTAAAAAACAGATCAAAATAGG + Intergenic
1047583899 8:126248145-126248167 TTGAAAACACAGGAGAAAATCGG - Intergenic
1048891694 8:138954110-138954132 TTGTAAACCAAAAATAAAATAGG + Intergenic
1049076952 8:140405208-140405230 TAGAAAACACAGACTAAAATGGG + Intronic
1050899960 9:10934553-10934575 AAGTAAACAAAGAATAAAATAGG + Intergenic
1051041183 9:12813465-12813487 TTCTATAGACAGATTCAAATTGG + Intronic
1052205654 9:25836484-25836506 TTGTATACACAGTTTAAACCAGG - Intergenic
1053547612 9:39040319-39040341 TTGTTATCAGAGATAAAAATTGG + Intergenic
1055003095 9:71475805-71475827 TTACAGACATAGATTAAAATGGG - Intergenic
1056531020 9:87487825-87487847 TTGTAAATTCTGGTTAAAATAGG - Intergenic
1057353297 9:94317532-94317554 ATGTAGACACAGATTTACATTGG - Intergenic
1057654454 9:96940060-96940082 ATGTAGACACAGATTTACATTGG + Intronic
1058242416 9:102582351-102582373 TTTTATAGAAAGATTAAAATAGG + Intergenic
1058594449 9:106600702-106600724 ATGTAACCACAGAATCAAATGGG + Intergenic
1058635032 9:107030179-107030201 TTGTAAACACCATTGAAAATAGG + Intergenic
1058901962 9:109449677-109449699 TTTTAAACCCAGATTCAAACGGG + Intronic
1059062071 9:111043830-111043852 TTGTGAAAACACATTGAAATTGG - Intergenic
1185974033 X:4698156-4698178 TAGTGCACACATATTAAAATGGG - Intergenic
1185995867 X:4948611-4948633 TTGAATGCACAAATTAAAATTGG - Intergenic
1186013238 X:5161614-5161636 TTCTGAACACAGATGAACATAGG - Intergenic
1188085907 X:25900505-25900527 TTGGAAACATAAATTAAAATTGG + Intergenic
1188085995 X:25902004-25902026 TTGGAAATATAAATTAAAATTGG - Intergenic
1188623055 X:32250332-32250354 TTGGAAACACATAATAAAAATGG + Intronic
1188920063 X:35962679-35962701 TTGTATACAAAGATACAAATAGG - Intronic
1189258194 X:39656692-39656714 TTGGAGAAACAGATTAAAAGAGG + Intergenic
1191647864 X:63503148-63503170 TTGTAAAGACAAATTGAAGTTGG + Intergenic
1192072835 X:67959207-67959229 TTGTAAGGACCGAATAAAATGGG + Intergenic
1192658346 X:73016087-73016109 TTATACAGACAGATTACAATAGG - Intergenic
1192868866 X:75166335-75166357 TTGTAATAACAGATAAAAATAGG + Intergenic
1193730823 X:85100754-85100776 TTGAAAACAAAGAATAATATTGG + Intronic
1193764942 X:85516188-85516210 TTGTCAACACTGATGATAATTGG - Intergenic
1194413664 X:93584024-93584046 TTGGAAACACAGCTCAAAAGAGG + Intergenic
1194422312 X:93691577-93691599 TTGAAAACGTAGAGTAAAATTGG - Intronic
1195746632 X:108125070-108125092 TTCTAGTTACAGATTAAAATAGG + Intronic
1196333605 X:114502620-114502642 TTGAAAACAGGCATTAAAATTGG + Intergenic
1196857087 X:119994529-119994551 TTTTAAAAACATATTAAAAAAGG - Intergenic
1196979411 X:121195317-121195339 TTGGAAACAAAAATAAAAATTGG + Intergenic
1197846307 X:130807333-130807355 ATGGAAAAGCAGATTAAAATTGG + Intronic
1197992249 X:132330742-132330764 TTTAGAACACATATTAAAATGGG + Intergenic
1198920910 X:141725682-141725704 ATGTAATCACACATAAAAATTGG - Intergenic
1199379607 X:147154412-147154434 TTGTATATACAGTTTAAATTAGG - Intergenic
1199783902 X:151087021-151087043 TTGGAAACAGGGATTCAAATAGG - Intergenic
1200270061 X:154674485-154674507 TGGAATACACAGAATAAAATGGG - Intergenic
1200445765 Y:3258704-3258726 TTATAAAGATACATTAAAATGGG + Intergenic
1201578542 Y:15487064-15487086 TTGTAAAAAAAAATTAAAAAGGG - Intergenic