ID: 974722025

View in Genome Browser
Species Human (GRCh38)
Location 4:65752586-65752608
Sequence TTTCCTGATGGCCTGTCCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974722017_974722025 3 Left 974722017 4:65752560-65752582 CCCACATCCAAGATTCCCAGCCT No data
Right 974722025 4:65752586-65752608 TTTCCTGATGGCCTGTCCTACGG No data
974722019_974722025 -4 Left 974722019 4:65752567-65752589 CCAAGATTCCCAGCCTGCCTTTC No data
Right 974722025 4:65752586-65752608 TTTCCTGATGGCCTGTCCTACGG No data
974722016_974722025 23 Left 974722016 4:65752540-65752562 CCTGTGGAAAAGGGCTTCAGCCC No data
Right 974722025 4:65752586-65752608 TTTCCTGATGGCCTGTCCTACGG No data
974722018_974722025 2 Left 974722018 4:65752561-65752583 CCACATCCAAGATTCCCAGCCTG No data
Right 974722025 4:65752586-65752608 TTTCCTGATGGCCTGTCCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974722025 Original CRISPR TTTCCTGATGGCCTGTCCTA CGG Intergenic
No off target data available for this crispr