ID: 974722369

View in Genome Browser
Species Human (GRCh38)
Location 4:65757151-65757173
Sequence AAGTAGTTCTTGTGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974722367_974722369 -7 Left 974722367 4:65757135-65757157 CCTCAGACTTTCATTAAAGTAGT No data
Right 974722369 4:65757151-65757173 AAGTAGTTCTTGTGAGAAGAGGG No data
974722365_974722369 27 Left 974722365 4:65757101-65757123 CCCTAAGGCTACTTGGATTCTGT No data
Right 974722369 4:65757151-65757173 AAGTAGTTCTTGTGAGAAGAGGG No data
974722366_974722369 26 Left 974722366 4:65757102-65757124 CCTAAGGCTACTTGGATTCTGTT No data
Right 974722369 4:65757151-65757173 AAGTAGTTCTTGTGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974722369 Original CRISPR AAGTAGTTCTTGTGAGAAGA GGG Intergenic
No off target data available for this crispr