ID: 974724105

View in Genome Browser
Species Human (GRCh38)
Location 4:65777061-65777083
Sequence CAAAATTCTGATAATGATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974724101_974724105 5 Left 974724101 4:65777033-65777055 CCCTAGAGACTTGTTGAATGGCT 0: 234
1: 252
2: 195
3: 100
4: 232
Right 974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG No data
974724102_974724105 4 Left 974724102 4:65777034-65777056 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974724105 Original CRISPR CAAAATTCTGATAATGATAC GGG Intergenic
No off target data available for this crispr