ID: 974725958

View in Genome Browser
Species Human (GRCh38)
Location 4:65798820-65798842
Sequence ATCTGATATGATTTGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974725958_974725965 3 Left 974725958 4:65798820-65798842 CCACTGGCCAAATCATATCAGAT No data
Right 974725965 4:65798846-65798868 TGGGCCTAGAATTGGAGTGGAGG No data
974725958_974725964 0 Left 974725958 4:65798820-65798842 CCACTGGCCAAATCATATCAGAT No data
Right 974725964 4:65798843-65798865 GGCTGGGCCTAGAATTGGAGTGG No data
974725958_974725963 -5 Left 974725958 4:65798820-65798842 CCACTGGCCAAATCATATCAGAT No data
Right 974725963 4:65798838-65798860 CAGATGGCTGGGCCTAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974725958 Original CRISPR ATCTGATATGATTTGGCCAG TGG (reversed) Intergenic
No off target data available for this crispr