ID: 974725961

View in Genome Browser
Species Human (GRCh38)
Location 4:65798827-65798849
Sequence CCCAGCCATCTGATATGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974725961_974725964 -7 Left 974725961 4:65798827-65798849 CCAAATCATATCAGATGGCTGGG No data
Right 974725964 4:65798843-65798865 GGCTGGGCCTAGAATTGGAGTGG No data
974725961_974725965 -4 Left 974725961 4:65798827-65798849 CCAAATCATATCAGATGGCTGGG No data
Right 974725965 4:65798846-65798868 TGGGCCTAGAATTGGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974725961 Original CRISPR CCCAGCCATCTGATATGATT TGG (reversed) Intergenic
No off target data available for this crispr