ID: 974725963

View in Genome Browser
Species Human (GRCh38)
Location 4:65798838-65798860
Sequence CAGATGGCTGGGCCTAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974725958_974725963 -5 Left 974725958 4:65798820-65798842 CCACTGGCCAAATCATATCAGAT No data
Right 974725963 4:65798838-65798860 CAGATGGCTGGGCCTAGAATTGG No data
974725956_974725963 23 Left 974725956 4:65798792-65798814 CCTGTGTTGTTGTCACATTTACT No data
Right 974725963 4:65798838-65798860 CAGATGGCTGGGCCTAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974725963 Original CRISPR CAGATGGCTGGGCCTAGAAT TGG Intergenic
No off target data available for this crispr