ID: 974725964

View in Genome Browser
Species Human (GRCh38)
Location 4:65798843-65798865
Sequence GGCTGGGCCTAGAATTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974725958_974725964 0 Left 974725958 4:65798820-65798842 CCACTGGCCAAATCATATCAGAT No data
Right 974725964 4:65798843-65798865 GGCTGGGCCTAGAATTGGAGTGG No data
974725961_974725964 -7 Left 974725961 4:65798827-65798849 CCAAATCATATCAGATGGCTGGG No data
Right 974725964 4:65798843-65798865 GGCTGGGCCTAGAATTGGAGTGG No data
974725956_974725964 28 Left 974725956 4:65798792-65798814 CCTGTGTTGTTGTCACATTTACT No data
Right 974725964 4:65798843-65798865 GGCTGGGCCTAGAATTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974725964 Original CRISPR GGCTGGGCCTAGAATTGGAG TGG Intergenic
No off target data available for this crispr