ID: 974725965

View in Genome Browser
Species Human (GRCh38)
Location 4:65798846-65798868
Sequence TGGGCCTAGAATTGGAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974725961_974725965 -4 Left 974725961 4:65798827-65798849 CCAAATCATATCAGATGGCTGGG No data
Right 974725965 4:65798846-65798868 TGGGCCTAGAATTGGAGTGGAGG No data
974725958_974725965 3 Left 974725958 4:65798820-65798842 CCACTGGCCAAATCATATCAGAT No data
Right 974725965 4:65798846-65798868 TGGGCCTAGAATTGGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974725965 Original CRISPR TGGGCCTAGAATTGGAGTGG AGG Intergenic
No off target data available for this crispr