ID: 974727213

View in Genome Browser
Species Human (GRCh38)
Location 4:65812531-65812553
Sequence AACAGCTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974727210_974727213 10 Left 974727210 4:65812498-65812520 CCATCTTCTGCAGATAACTACTA No data
Right 974727213 4:65812531-65812553 AACAGCTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974727213 Original CRISPR AACAGCTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr