ID: 974728034

View in Genome Browser
Species Human (GRCh38)
Location 4:65822019-65822041
Sequence CTTAAAAAATAAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974728034_974728037 17 Left 974728034 4:65822019-65822041 CCTTCCTCCTTTTATTTTTTAAG No data
Right 974728037 4:65822059-65822081 TAATTAAACTATGTCCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974728034 Original CRISPR CTTAAAAAATAAAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr