ID: 974736373

View in Genome Browser
Species Human (GRCh38)
Location 4:65938706-65938728
Sequence GCAGATCAGTCGTCTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974736373_974736380 -6 Left 974736373 4:65938706-65938728 CCCTCCCCAGACGACTGATCTGC No data
Right 974736380 4:65938723-65938745 ATCTGCCTGGGCCTTGATCTTGG No data
974736373_974736383 16 Left 974736373 4:65938706-65938728 CCCTCCCCAGACGACTGATCTGC No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974736373 Original CRISPR GCAGATCAGTCGTCTGGGGA GGG (reversed) Intergenic
No off target data available for this crispr