ID: 974736374

View in Genome Browser
Species Human (GRCh38)
Location 4:65938707-65938729
Sequence GGCAGATCAGTCGTCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974736374_974736383 15 Left 974736374 4:65938707-65938729 CCTCCCCAGACGACTGATCTGCC No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data
974736374_974736380 -7 Left 974736374 4:65938707-65938729 CCTCCCCAGACGACTGATCTGCC No data
Right 974736380 4:65938723-65938745 ATCTGCCTGGGCCTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974736374 Original CRISPR GGCAGATCAGTCGTCTGGGG AGG (reversed) Intergenic
No off target data available for this crispr