ID: 974736375

View in Genome Browser
Species Human (GRCh38)
Location 4:65938710-65938732
Sequence CCAGGCAGATCAGTCGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974736375_974736380 -10 Left 974736375 4:65938710-65938732 CCCCAGACGACTGATCTGCCTGG No data
Right 974736380 4:65938723-65938745 ATCTGCCTGGGCCTTGATCTTGG No data
974736375_974736383 12 Left 974736375 4:65938710-65938732 CCCCAGACGACTGATCTGCCTGG No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974736375 Original CRISPR CCAGGCAGATCAGTCGTCTG GGG (reversed) Intergenic