ID: 974736377

View in Genome Browser
Species Human (GRCh38)
Location 4:65938711-65938733
Sequence CCCAGGCAGATCAGTCGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974736377_974736383 11 Left 974736377 4:65938711-65938733 CCCAGACGACTGATCTGCCTGGG No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974736377 Original CRISPR CCCAGGCAGATCAGTCGTCT GGG (reversed) Intergenic
No off target data available for this crispr