ID: 974736379

View in Genome Browser
Species Human (GRCh38)
Location 4:65938712-65938734
Sequence GCCCAGGCAGATCAGTCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974736379_974736383 10 Left 974736379 4:65938712-65938734 CCAGACGACTGATCTGCCTGGGC No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974736379 Original CRISPR GCCCAGGCAGATCAGTCGTC TGG (reversed) Intergenic
No off target data available for this crispr