ID: 974736380

View in Genome Browser
Species Human (GRCh38)
Location 4:65938723-65938745
Sequence ATCTGCCTGGGCCTTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974736373_974736380 -6 Left 974736373 4:65938706-65938728 CCCTCCCCAGACGACTGATCTGC No data
Right 974736380 4:65938723-65938745 ATCTGCCTGGGCCTTGATCTTGG No data
974736375_974736380 -10 Left 974736375 4:65938710-65938732 CCCCAGACGACTGATCTGCCTGG No data
Right 974736380 4:65938723-65938745 ATCTGCCTGGGCCTTGATCTTGG No data
974736374_974736380 -7 Left 974736374 4:65938707-65938729 CCTCCCCAGACGACTGATCTGCC No data
Right 974736380 4:65938723-65938745 ATCTGCCTGGGCCTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974736380 Original CRISPR ATCTGCCTGGGCCTTGATCT TGG Intergenic