ID: 974736381

View in Genome Browser
Species Human (GRCh38)
Location 4:65938728-65938750
Sequence GAAGTCCAAGATCAAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6580
Summary {0: 14, 1: 241, 2: 1132, 3: 2187, 4: 3006}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974736381_974736383 -6 Left 974736381 4:65938728-65938750 CCTGGGCCTTGATCTTGGACTTC 0: 14
1: 241
2: 1132
3: 2187
4: 3006
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974736381 Original CRISPR GAAGTCCAAGATCAAGGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr