ID: 974736383

View in Genome Browser
Species Human (GRCh38)
Location 4:65938745-65938767
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974736379_974736383 10 Left 974736379 4:65938712-65938734 CCAGACGACTGATCTGCCTGGGC No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data
974736377_974736383 11 Left 974736377 4:65938711-65938733 CCCAGACGACTGATCTGCCTGGG No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data
974736373_974736383 16 Left 974736373 4:65938706-65938728 CCCTCCCCAGACGACTGATCTGC No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data
974736375_974736383 12 Left 974736375 4:65938710-65938732 CCCCAGACGACTGATCTGCCTGG No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data
974736381_974736383 -6 Left 974736381 4:65938728-65938750 CCTGGGCCTTGATCTTGGACTTC No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data
974736374_974736383 15 Left 974736374 4:65938707-65938729 CCTCCCCAGACGACTGATCTGCC No data
Right 974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type