ID: 974741296 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:66011764-66011786 |
Sequence | TGTCTAATACTGACATTGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
974741292_974741296 | 13 | Left | 974741292 | 4:66011728-66011750 | CCTAAATATCCTTGTTAATTTTC | 0: 69 1: 1317 2: 1850 3: 3614 4: 4309 |
||
Right | 974741296 | 4:66011764-66011786 | TGTCTAATACTGACATTGGGTGG | No data | ||||
974741293_974741296 | 4 | Left | 974741293 | 4:66011737-66011759 | CCTTGTTAATTTTCTGTCTCGTT | 0: 347 1: 2932 2: 4851 3: 2861 4: 1774 |
||
Right | 974741296 | 4:66011764-66011786 | TGTCTAATACTGACATTGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
974741296 | Original CRISPR | TGTCTAATACTGACATTGGG TGG | Intergenic | ||
No off target data available for this crispr |