ID: 974741296

View in Genome Browser
Species Human (GRCh38)
Location 4:66011764-66011786
Sequence TGTCTAATACTGACATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974741292_974741296 13 Left 974741292 4:66011728-66011750 CCTAAATATCCTTGTTAATTTTC 0: 69
1: 1317
2: 1850
3: 3614
4: 4309
Right 974741296 4:66011764-66011786 TGTCTAATACTGACATTGGGTGG No data
974741293_974741296 4 Left 974741293 4:66011737-66011759 CCTTGTTAATTTTCTGTCTCGTT 0: 347
1: 2932
2: 4851
3: 2861
4: 1774
Right 974741296 4:66011764-66011786 TGTCTAATACTGACATTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974741296 Original CRISPR TGTCTAATACTGACATTGGG TGG Intergenic
No off target data available for this crispr