ID: 974742203

View in Genome Browser
Species Human (GRCh38)
Location 4:66021535-66021557
Sequence CGCAAGGGTGGAGCCACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974742203_974742211 21 Left 974742203 4:66021535-66021557 CCTTGGGTGGCTCCACCCTTGCG No data
Right 974742211 4:66021579-66021601 CTCCTGACTGCTTTCATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974742203 Original CRISPR CGCAAGGGTGGAGCCACCCA AGG (reversed) Intergenic
No off target data available for this crispr