ID: 974742567

View in Genome Browser
Species Human (GRCh38)
Location 4:66025062-66025084
Sequence GGGGGTGCGGGCCGAGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974742554_974742567 21 Left 974742554 4:66025018-66025040 CCTGAACACAGGGAAGGGAAAAA No data
Right 974742567 4:66025062-66025084 GGGGGTGCGGGCCGAGAAAAGGG No data
974742562_974742567 -10 Left 974742562 4:66025049-66025071 CCGGGGCCAGTTCGGGGGTGCGG No data
Right 974742567 4:66025062-66025084 GGGGGTGCGGGCCGAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974742567 Original CRISPR GGGGGTGCGGGCCGAGAAAA GGG Intergenic