ID: 974743719

View in Genome Browser
Species Human (GRCh38)
Location 4:66042321-66042343
Sequence CTCAAACAAAAAATGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974743715_974743719 30 Left 974743715 4:66042268-66042290 CCTTGAATTCTGTATACAGTAAA No data
Right 974743719 4:66042321-66042343 CTCAAACAAAAAATGGGCCATGG No data
974743716_974743719 2 Left 974743716 4:66042296-66042318 CCTTCAAATGTGAAAGAAAACTT No data
Right 974743719 4:66042321-66042343 CTCAAACAAAAAATGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974743719 Original CRISPR CTCAAACAAAAAATGGGCCA TGG Intergenic
No off target data available for this crispr