ID: 974746912

View in Genome Browser
Species Human (GRCh38)
Location 4:66088890-66088912
Sequence CTTGGTCTGTTACTGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 14, 1: 178, 2: 170, 3: 117, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974746912_974746917 22 Left 974746912 4:66088890-66088912 CCAAAGCCCAGTAACAGACCAAG 0: 14
1: 178
2: 170
3: 117
4: 237
Right 974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG No data
974746912_974746918 23 Left 974746912 4:66088890-66088912 CCAAAGCCCAGTAACAGACCAAG 0: 14
1: 178
2: 170
3: 117
4: 237
Right 974746918 4:66088936-66088958 GTTATCTTCAGAAGATGGCAGGG No data
974746912_974746916 18 Left 974746912 4:66088890-66088912 CCAAAGCCCAGTAACAGACCAAG 0: 14
1: 178
2: 170
3: 117
4: 237
Right 974746916 4:66088931-66088953 AAGTAGTTATCTTCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974746912 Original CRISPR CTTGGTCTGTTACTGGGCTT TGG (reversed) Intergenic
900434963 1:2625619-2625641 CTTGGCCCGTTACTGGGCTTTGG + Intronic
900995687 1:6122103-6122125 CTTGGTTTGCTTCTTGGCTTTGG - Intronic
901904046 1:12392641-12392663 CTTGGCCTGTTACTGGGCTTTGG - Intronic
904179489 1:28655928-28655950 CTTGGCCTATTACTGGGCTTTGG - Intergenic
904335937 1:29798029-29798051 CTTGGCCTATTACTGGGCTTTGG + Intergenic
904419574 1:30383006-30383028 CCTGGCTTGCTACTGGGCTTTGG - Intergenic
904452840 1:30627347-30627369 ATTGGTCTGTTACTGAGCAGTGG - Intergenic
904823847 1:33262073-33262095 CTGGGGCTGGAACTGGGCTTTGG + Intronic
905354070 1:37368826-37368848 CTTGGCCTGTTACTTGGCTTTGG + Intergenic
905465229 1:38148142-38148164 CTTAGCCTGTTACTGGGCTTTGG + Intergenic
905538044 1:38739203-38739225 CTTTGTCTTTTTCTGAGCTTTGG + Intergenic
906050493 1:42867457-42867479 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
906538324 1:46564821-46564843 CTTGGACTGTTAGTTGGGTTGGG - Intronic
906825118 1:48971121-48971143 CTTGGACAGGTACTGGGCTGTGG + Intronic
906879679 1:49576506-49576528 TTTGGCTTGTTACTGGGCTTTGG + Intronic
907429323 1:54402885-54402907 CTTGTTCTGTCCCTGGGCCTCGG - Intronic
907597346 1:55732173-55732195 CTTAGACTGTTACTGAACTTTGG + Intergenic
907780346 1:57560877-57560899 CTTGGCCTGTTACTGGGCTTTGG + Intronic
908052315 1:60246756-60246778 TTCGGCCTGTTGCTGGGCTTTGG + Intergenic
909172603 1:72315423-72315445 CTTGTCCTCTTACTGGGCTTTGG - Intergenic
909548944 1:76877140-76877162 CTTTTGCTGTTACTGGGCTTTGG - Intronic
909576925 1:77185901-77185923 CTTGGCCTGTTACTGGGCTTTGG + Intronic
909810958 1:79931380-79931402 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
910226689 1:84943227-84943249 CCTGGTCTCTAACTGGACTTGGG + Intronic
910370639 1:86512171-86512193 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
910630226 1:89346295-89346317 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
910638987 1:89439931-89439953 CTTGGCCTGTTACTGGACTTTGG - Intergenic
910790326 1:91043763-91043785 GTTGGCCTGTTACTGGGCTTTGG + Intergenic
910831093 1:91463381-91463403 CTTGGCCTGTTATTGGGCTTTGG - Intergenic
910948218 1:92616731-92616753 GTTGGCCTGTTACTGGACTTTGG + Intronic
911109093 1:94164162-94164184 CTTGGCCTGTTACTGGGCTTTGG - Intronic
911257320 1:95647321-95647343 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
911738393 1:101361876-101361898 CTTGGCCTGTTACTGGGCTTCGG - Intergenic
911943943 1:104082394-104082416 GTCAGTCTGTTACTGGGCTGTGG - Intergenic
911980430 1:104559464-104559486 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
911981895 1:104579219-104579241 CTTGGCCTGTTATTGGGCTTTGG - Intergenic
912212257 1:107568937-107568959 CTTGGATTGCTACTGGGCTTTGG + Intergenic
912252024 1:108021345-108021367 CTTGGGTTGTTACTGGGCTTTGG - Intergenic
912733318 1:112128786-112128808 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
912943808 1:114068161-114068183 TTTAGCCTGTTACTGGGCTTTGG - Intergenic
913039442 1:115008352-115008374 CTTGTCCTGTTACTGGGATTTGG - Intergenic
914477524 1:148036285-148036307 CTTTGTCCGTTCCTGGGCATAGG + Intergenic
916106325 1:161435284-161435306 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
916285321 1:163099571-163099593 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
916873122 1:168938829-168938851 CTTGGTTTGATCCTTGGCTTTGG - Intergenic
917217209 1:172690870-172690892 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
917246140 1:173003403-173003425 CTTGCTCTGTTACCAGGCTGGGG - Intergenic
917462712 1:175246226-175246248 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
918141581 1:181724515-181724537 CTTGGTCAGTTCCTGGGCGTTGG - Exonic
918755709 1:188337766-188337788 CTTGGCCCGTTACTGGGTTTTGG - Intergenic
918774497 1:188610790-188610812 CTTTGCCTGTTACTGGGCTTTGG + Intergenic
918815083 1:189171271-189171293 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
918918226 1:190671836-190671858 CTTGGCCTGTTAATGGGGTTTGG - Intergenic
918958249 1:191237992-191238014 CTTGGCCTGTTACTGGCCTTTGG + Intergenic
919124611 1:193379738-193379760 CTTAGCCTGTTACTGAACTTTGG - Intergenic
919241777 1:194924247-194924269 ATTGGCCTGTTAATGGGCATTGG + Intergenic
919569415 1:199227566-199227588 CTTGGTCTGAGACTGGTCTATGG - Intergenic
919962422 1:202485157-202485179 CTTTGGCTGTTCCTGGGGTTGGG + Intronic
920197436 1:204238409-204238431 GTTGGTCTGTTACTGGGCTTTGG + Intronic
920970405 1:210738594-210738616 CTTGCTCTGTCACTAGGCTCCGG + Intronic
922039859 1:221886359-221886381 CTTGGTCTGTTTAGGAGCTTGGG - Intergenic
922344819 1:224687713-224687735 ATTGGTCTGTTACTGTGCAAGGG - Intronic
922781046 1:228252538-228252560 CTTGGCCTGTTACTGAGCTTTGG - Intronic
922786830 1:228287056-228287078 CCTGGCCTGTGGCTGGGCTTTGG - Intronic
923253565 1:232199394-232199416 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
924840772 1:247707789-247707811 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
924847128 1:247785094-247785116 TTGGGCCTATTACTGGGCTTTGG - Intergenic
1063216655 10:3931547-3931569 CTTGGTCTGTTACCTGGTTTTGG - Intergenic
1064345643 10:14530666-14530688 CTTGGAATGTAACTGGGCTGGGG + Intronic
1064545684 10:16448092-16448114 CTTGGCCAGTTACTGGGCTTTGG - Intronic
1065005330 10:21374207-21374229 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1066156045 10:32679195-32679217 ATTGGCCTTTTATTGGGCTTTGG - Intronic
1066167023 10:32799187-32799209 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1066169432 10:32826361-32826383 CTTGTCCTATTACTGGGCTTTGG + Intronic
1067125549 10:43512501-43512523 CTTGGCCTATTACTGGGCTCTGG - Intergenic
1067333141 10:45340260-45340282 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
1067518970 10:46980528-46980550 TTTGGCCTGCTACTGGGCCTTGG + Intronic
1067643276 10:48071306-48071328 TTTGGCCTGCTACTGGGCCTTGG - Intergenic
1067754346 10:48993676-48993698 CTTGGTTTGTTACTGAGCTTTGG - Intergenic
1068007669 10:51409527-51409549 CTTGGCCTGTCACTGGGCTTTGG - Intronic
1068447214 10:57138636-57138658 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1068837212 10:61568335-61568357 CTTGGCCTGTTACTGGGCTGTGG - Intergenic
1069192299 10:65506327-65506349 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1069790825 10:71019540-71019562 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1070275634 10:75003536-75003558 CTTGGGCTTTTGCTGGGTTTTGG + Intronic
1070897290 10:79995731-79995753 CCTAGTCTGCTACTGGGCCTTGG + Intergenic
1071267080 10:83973959-83973981 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1071673923 10:87637386-87637408 TTTGGCCTGTTACTGGGCCTTGG - Intergenic
1071937692 10:90549319-90549341 CTTGGCCTGTTCCTGGGCTTTGG + Intergenic
1071942778 10:90607735-90607757 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1072360472 10:94654186-94654208 CTTGGACTGTTACTCGGCTTTGG + Intergenic
1072994603 10:100231843-100231865 CTGGGTTGGTTACAGGGCTTTGG - Intergenic
1073557353 10:104465943-104465965 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
1073656677 10:105424441-105424463 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1073918472 10:108432272-108432294 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1073957678 10:108891610-108891632 CTTGGCCTGTTACTGGGCCTCGG - Intergenic
1073995869 10:109314674-109314696 CTTGGCTTATTACTGGGCTTTGG - Intergenic
1075249717 10:120855916-120855938 CTTGTCCTGTTCCTGAGCTTAGG + Intronic
1075606793 10:123817442-123817464 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1076772625 10:132674796-132674818 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1076850324 10:133089226-133089248 CCTGGTCTGTGCCTGGGCTGGGG + Intronic
1076927412 10:133499183-133499205 CTTAGCCTGTTACTGGGCTTTGG - Intergenic
1077899420 11:6477330-6477352 CCTGGTCTGTGCCTGGGCTCAGG - Intronic
1078310677 11:10237948-10237970 TTTGGGCTGTTTCTGGGTTTTGG + Intronic
1080076597 11:28157538-28157560 CTTGGCCTGTTACTGGGCATTGG + Intronic
1080866062 11:36196117-36196139 CTGGGTCTGTTTCTGAGCTCTGG + Intronic
1081065457 11:38534859-38534881 CTTGGCTTGTTATTGGGCTTCGG - Intergenic
1081072780 11:38631138-38631160 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1081942161 11:46952843-46952865 ATTGGTTTGTTGCTGGGCGTTGG + Intronic
1082225502 11:49702312-49702334 CTTAAAGTGTTACTGGGCTTGGG - Intergenic
1082671703 11:56043059-56043081 CTTTGCCTGCTACTGGGCTTTGG + Intergenic
1083093147 11:60221144-60221166 CTTGCCCTGTTACTGGACTTTGG + Intronic
1084068515 11:66719117-66719139 CTTTGTCTGTTTCTGAGCTGGGG - Intronic
1084757649 11:71249932-71249954 CTTGGTCTAGGCCTGGGCTTGGG - Intronic
1085747574 11:79128257-79128279 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1085954691 11:81377576-81377598 CTATGTCTGGTATTGGGCTTTGG - Intergenic
1086434216 11:86765230-86765252 CCAGGTCTGTTGCTGGGCCTGGG + Intergenic
1086623575 11:88917265-88917287 CTTAAAGTGTTACTGGGCTTGGG + Intronic
1086730153 11:90239011-90239033 CTTGCTTTGTTACTGATCTTAGG + Intergenic
1086834119 11:91600410-91600432 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1087374025 11:97320571-97320593 CTTGGCCTGTTGCTAGGCTTTGG + Intergenic
1088097208 11:106115175-106115197 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1088097725 11:106119456-106119478 CTTTCTCTGTCACTGAGCTTTGG - Intergenic
1088191657 11:107234473-107234495 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1088449357 11:109965385-109965407 CTTGGCCTGTTACCAGGCTTTGG + Intergenic
1088836659 11:113583406-113583428 CTTGGCCTGTCACTGGGCTTTGG + Intergenic
1088938088 11:114425164-114425186 CTTACAGTGTTACTGGGCTTGGG - Intronic
1089903609 11:122013626-122013648 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1090209489 11:124908033-124908055 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1090221613 11:125031568-125031590 CTTAGCCTGTTACTGGACTTTGG - Intronic
1091051741 11:132378773-132378795 TTTGGCCTGTTACTGAGCTTTGG + Intergenic
1091687791 12:2575940-2575962 CTAGGTCTGTCTCTGGGTTTGGG - Intronic
1091708531 12:2718637-2718659 CTTGGCCTGTAAATTGGCTTAGG - Intergenic
1092381563 12:8000956-8000978 CCTGGTCTGTTACTGAGCTTTGG + Intergenic
1093031867 12:14295932-14295954 GTTGGCCTGTTACTGGGCTTTGG - Intergenic
1093036340 12:14335701-14335723 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1093645732 12:21583688-21583710 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1093964542 12:25310974-25310996 CTTGGCCTGTTGCTGAGCTTTGG + Intergenic
1094102534 12:26779280-26779302 CTTGGTCTGGTACTGGGCTTTGG + Intronic
1095121503 12:38424826-38424848 CTTGGCCTGTGACAGGGCTTTGG - Intergenic
1095539048 12:43286903-43286925 CTTGCTCTGTTGCTAGGCTGGGG - Intergenic
1095603857 12:44044352-44044374 CTTGGCCTGTTTCTGGGCTTTGG + Intronic
1095628070 12:44341620-44341642 CTTGGCCTGTGACTGTGTTTGGG + Intronic
1095844392 12:46729950-46729972 CTTGGCCTGTTAATGGGCTAAGG - Intergenic
1095856237 12:46863657-46863679 CTTGGCCTGTTACTGGGCTTAGG - Intergenic
1096288715 12:50322978-50323000 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
1096457463 12:51799419-51799441 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1096535932 12:52274657-52274679 CTTGGGCTGAAGCTGGGCTTTGG + Exonic
1096578701 12:52570669-52570691 CTTGGTCTGGTACAGGGCCTCGG + Exonic
1096584898 12:52613688-52613710 CTTGGTCTGGTACAGGGCCTCGG + Exonic
1096587461 12:52632097-52632119 CTTGGTCTGGTACAGGGCCTCGG + Intergenic
1096595787 12:52694626-52694648 CTTGGTCTGGTACAGGGCTTCGG + Exonic
1096599220 12:52717667-52717689 CTTGGTCTGGTACAGGGCCTCGG + Intergenic
1096603594 12:52748162-52748184 CTTGGTCTGGTACAGGGTCTGGG + Intergenic
1096614520 12:52824198-52824220 CTTGGTCTGGTACCAGGCCTCGG + Exonic
1097437835 12:59572236-59572258 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1097521749 12:60679230-60679252 GTTGCTCTGTTCCTGGGCTCAGG - Intergenic
1097821338 12:64131846-64131868 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1097843354 12:64342743-64342765 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1098673044 12:73254262-73254284 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1098716093 12:73829833-73829855 CTTGGCCCGTTACTGGGCTTTGG + Intergenic
1098731054 12:74037366-74037388 GTTGGCCTGTTACTGGGCTTTGG + Intergenic
1099183377 12:79492570-79492592 CTTGGCCTATTACCGAGCTTTGG - Intergenic
1099365927 12:81765402-81765424 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1099375650 12:81893975-81893997 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1099379379 12:81936522-81936544 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1099508564 12:83507205-83507227 CTTGGCCTGCTACTGGGCTTCGG + Intergenic
1099689783 12:85938055-85938077 CTTTGTCTGTTACTGGGCTTTGG + Intergenic
1099735785 12:86565057-86565079 CTTGGCCTGTTACTGCGCTTTGG + Intronic
1100083306 12:90878230-90878252 CTTTGCCTGTTACTGGGCTTTGG + Intergenic
1100241149 12:92711590-92711612 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1101264134 12:103066140-103066162 CTTGGCCAATTACTGGGATTTGG + Intergenic
1101534665 12:105606086-105606108 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1101543074 12:105682654-105682676 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1102685387 12:114720767-114720789 CTTTGTCTGAAACTGGGTTTTGG + Intergenic
1102686987 12:114732517-114732539 ATTGGCCTGTTGCTGTGCTTTGG - Intergenic
1102757253 12:115352319-115352341 GTTGCTCTGTTAGTGGGCATAGG + Intergenic
1103035613 12:117654081-117654103 CTTGGCCTGTTACTAAGCTTTGG + Intronic
1103396530 12:120611465-120611487 CTTGACCTGTTACTGGGCTGTGG + Intergenic
1103758311 12:123228654-123228676 CTTGCTCTGTCACTAGGCTGGGG - Intronic
1103844195 12:123890090-123890112 ATTGGCCGGTTCCTGGGCTTAGG + Intronic
1104182051 12:126391083-126391105 CTTGCTTTATTACTGGCCTTGGG + Intergenic
1104320414 12:127745531-127745553 CTTTGTTTGTTCCTGGGCATAGG - Intergenic
1105037117 12:132933619-132933641 ATTGATCTGTTTCTGGGTTTTGG - Intronic
1105740112 13:23315194-23315216 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1106762092 13:32877332-32877354 CTTGGCATGCTACTGGGCCTTGG + Intergenic
1106905534 13:34405413-34405435 CCTGGTGTGTTACTGGGCTGTGG - Intergenic
1107226909 13:38061093-38061115 CTGGGTCTGCTGCTCGGCTTTGG - Intergenic
1107657694 13:42608967-42608989 CTTGGACTGTTACTGTGCAGTGG - Intergenic
1107983573 13:45755954-45755976 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1108302431 13:49091967-49091989 CTTGGCCCGTTACTGGGCTTTGG - Intronic
1108904279 13:55449989-55450011 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
1108914299 13:55588853-55588875 CTTGGCATGTTACTAGGCTTTGG - Intergenic
1109174233 13:59135649-59135671 CTTGGTATGTTCCTAGGATTAGG - Intergenic
1109293227 13:60500136-60500158 CTTGGCCTGTTACTGGGTTTTGG + Intronic
1109519025 13:63484819-63484841 CTTGGCTTGTTACTGGGCTTTGG + Intergenic
1109583051 13:64366185-64366207 CTTGGCCTGTTACTGGGCTTCGG + Intergenic
1109951021 13:69502187-69502209 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1110834132 13:80064611-80064633 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1111317505 13:86581819-86581841 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1112231125 13:97590146-97590168 CTTGGTTTGTTACTGGTCTTTGG - Intergenic
1113985413 13:114311164-114311186 CTAGCTCTGTTGCTGGGCTTTGG - Intergenic
1114205873 14:20570787-20570809 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1114758255 14:25283858-25283880 CTTCACCTGTTACTGGGCTTTGG - Intergenic
1114905374 14:27120404-27120426 ATTGGCCTGTTACTTGTCTTTGG - Intergenic
1115059719 14:29173912-29173934 CTTGGCTTGTAACTGGGCTTTGG + Intergenic
1115070787 14:29319642-29319664 CTTAGCCTGCTACTGGGCCTTGG + Intergenic
1115130696 14:30049278-30049300 CTTGGCCTGTCACTGGGCTTTGG + Intronic
1115143402 14:30199405-30199427 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
1115292240 14:31785304-31785326 CATGGTCTGGTACTGGTCTGTGG - Intronic
1116058911 14:39896956-39896978 CTTGGCCTGTTGCTGGGCTTTGG + Intergenic
1116068097 14:40009189-40009211 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1116158375 14:41236647-41236669 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1116531453 14:45978207-45978229 CTTGGACTGTTACTAGGCTTTGG - Intergenic
1117596272 14:57329865-57329887 TTTGGCCTGTTATTGAGCTTTGG - Intergenic
1117634136 14:57724391-57724413 GTTGGCCTGTTACTGGGTTTTGG + Intronic
1118122431 14:62860152-62860174 CTTAGCCTGTTACTGGGCTTTGG - Intronic
1118415107 14:65527587-65527609 TTTGTTCTGTTGCTGGCCTTTGG + Intronic
1118880771 14:69824000-69824022 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1119107561 14:71938821-71938843 CTTGGCCTATTACTGGGCTTTGG - Intronic
1120082022 14:80227512-80227534 CTTTGCCTGTTCCTGGGCCTTGG - Intronic
1120231421 14:81845233-81845255 GTTGGCCTGTTACTGGACTGTGG - Intergenic
1120555989 14:85930420-85930442 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1122306995 14:100772734-100772756 CTTGGGCGGTTACAGGGCGTGGG - Intergenic
1122647550 14:103205475-103205497 CTTTGTCTGTTACTGCCTTTGGG + Intergenic
1125088519 15:35761305-35761327 TTTGGTTTGTTACTGCCCTTTGG + Intergenic
1125679119 15:41519963-41519985 CTTGCTCTGTCACTGGGCTGGGG + Intronic
1126191309 15:45881786-45881808 CTTGGTATGCTGCTGGGCCTTGG - Intergenic
1126283613 15:46986295-46986317 CTTGGCCTGTTATTGGGCTCTGG + Intergenic
1126523940 15:49629206-49629228 TTTGATCTGTTTCTGTGCTTTGG + Intronic
1127356919 15:58209207-58209229 CTTGGCCTGTTATTGGGCTTTGG + Intronic
1128328886 15:66742846-66742868 CTGGCTTTGTTTCTGGGCTTGGG + Intronic
1128536132 15:68491979-68492001 CTGTGCCTGTCACTGGGCTTGGG - Intergenic
1129905852 15:79186657-79186679 TCTGCTCTGTTGCTGGGCTTGGG + Intergenic
1130049727 15:80473801-80473823 CCTGCTCAGTTACTGGGATTTGG + Intronic
1130575076 15:85084877-85084899 CTTGGTCAGTGACTGGATTTAGG - Intronic
1131724013 15:95202813-95202835 CTTGGCCTGTTACCGGGCTTTGG + Intergenic
1132984104 16:2754900-2754922 TTGGGTCTGCTACTGGGCTTGGG + Intronic
1133675393 16:8066083-8066105 ATTGGTCTGTTACTGTGCAATGG + Intergenic
1134321231 16:13166257-13166279 CCTTTTCTGTTTCTGGGCTTTGG + Intronic
1134325407 16:13203057-13203079 CTTTGACTGTTACTGAGATTGGG + Intronic
1138868387 16:60850800-60850822 CTTTTCCTGTTATTGGGCTTTGG + Intergenic
1140999038 16:80290543-80290565 CTTGGTCTGTAACTGGGAAAGGG - Intergenic
1141020974 16:80496212-80496234 CTTTGTCTTTTAATGGTCTTGGG - Intergenic
1141559540 16:84858020-84858042 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1141850451 16:86641620-86641642 CTGGGTCTGTCTCTGGGCCTAGG + Intergenic
1143848639 17:9792790-9792812 CTTGCTCTGTCACTAGGCTGAGG + Intronic
1146237986 17:31185966-31185988 CTTGACCTGTTACTGGGCTTTGG + Intronic
1146521258 17:33527282-33527304 CTTGGTCTTTGAATGGGTTTAGG - Intronic
1146836358 17:36114018-36114040 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1146850936 17:36221058-36221080 CTTAGCCTGTTACTGGGCTTTGG + Intronic
1150218235 17:63481866-63481888 CTGGGTCTGTTCCAGGGCTAGGG + Intergenic
1151885437 17:76920776-76920798 CTTGGTCACTCACTGGCCTTTGG - Intronic
1152899129 17:82929912-82929934 CTTGGTCTGTGGCTGAGCTGTGG + Intronic
1153089712 18:1330176-1330198 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1154129532 18:11724810-11724832 CTTGGCCTGCTCCTGGGCCTTGG - Intronic
1154252669 18:12757261-12757283 CTTGGCCTGTTACTAGGCTTTGG - Intergenic
1154506175 18:15042904-15042926 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1155940710 18:31799612-31799634 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
1156303863 18:35858708-35858730 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1156582553 18:38394478-38394500 CTTAGCCTATTACTGGGCTTTGG + Intergenic
1156606374 18:38671779-38671801 CTTGGCCTGTGATTGGGCTTTGG + Intergenic
1156990300 18:43400761-43400783 CTTGGGCTATTACTGGGCGTTGG - Intergenic
1157341205 18:46780041-46780063 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1157870929 18:51229567-51229589 CTTGGTCTGCTACTGGGCCTTGG - Intergenic
1157998503 18:52588110-52588132 CTTGGCCTGTTACTGGACTTTGG - Intronic
1159060414 18:63508930-63508952 CTTTGTCTGTTCCAGGCCTTGGG - Intergenic
1159287791 18:66375496-66375518 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1159559102 18:69975337-69975359 CTTGGCTTGTTACTGGGCTTTGG - Intergenic
1160092466 18:75840029-75840051 CTTGGCCTGTTACTGGGCTCTGG + Intergenic
1160299063 18:77662900-77662922 ATTGGTCTGTAACTGGGCAGTGG + Intergenic
1160532183 18:79571978-79572000 CTCGGGCTTTTCCTGGGCTTGGG - Intergenic
1161075958 19:2285900-2285922 CTTGGTCTGGTCCTGGTTTTAGG + Intronic
1163084700 19:14971096-14971118 CTTGCTCTGTTACCAGGCTGGGG - Intronic
1163427784 19:17248463-17248485 CTTGTTCTGTTTCTGGGGTCAGG + Intronic
1163671235 19:18629922-18629944 CTTTTTCTGGCACTGGGCTTAGG + Intergenic
1163840872 19:19608952-19608974 CCAGGTCTGGTGCTGGGCTTGGG - Intronic
1164097083 19:22021329-22021351 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1164117255 19:22234560-22234582 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1167312467 19:48745124-48745146 CTTGGTCAGATACTAGGCTGTGG - Intronic
925279955 2:2676882-2676904 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
925460729 2:4060460-4060482 CTTTGTCTATTACTGGGCTTTGG + Intergenic
925519646 2:4729240-4729262 CTTGGTTTGTTCCTGATCTTGGG - Intergenic
926810393 2:16750662-16750684 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
926825565 2:16902216-16902238 CTTGGCTTGTTACTGAGCTTTGG - Intergenic
926826765 2:16913682-16913704 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
927008720 2:18879738-18879760 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
927312580 2:21647895-21647917 AGTGTTCTGTTACTAGGCTTTGG + Intergenic
927660434 2:24988683-24988705 CTTGGCCTGTTACTGGTCTTTGG + Intergenic
929067485 2:37993548-37993570 CTTGCTTTGTTTCTGGCCTTTGG - Intronic
929269823 2:39960767-39960789 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
930418607 2:51121009-51121031 TTTGGCCTGTTACTGGGCCTTGG + Intergenic
930536608 2:52652248-52652270 CTTGGCCTGTTACTAAGCTTTGG - Intergenic
932347723 2:71006537-71006559 TTTGGTCTCTTACTGGTCTCTGG - Intergenic
932543574 2:72683324-72683346 CTTCCTCTGTTACTGGACATTGG - Intronic
932841318 2:75085411-75085433 ATTGGTCTGTTACTGCGCAATGG + Intronic
932870703 2:75395067-75395089 CCTGGCCTGTTACTGGGCTTTGG - Intergenic
933181766 2:79235448-79235470 CCTGGTCTGCTCCTGGGCCTTGG + Intronic
933396879 2:81743291-81743313 CTTGTTCTGTTTCTGATCTTAGG - Intergenic
935183938 2:100714915-100714937 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
935425107 2:102911311-102911333 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
935694679 2:105761026-105761048 CCTGGTCTGTGACTGGGCTCAGG + Intronic
935944627 2:108274349-108274371 CTTGGCCTGCTACTGGGCCTAGG - Intergenic
936084989 2:109461291-109461313 CTTGGTCTGCCACTGGGCCTTGG - Intronic
936641228 2:114314706-114314728 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
937460014 2:122077487-122077509 TTTGGTCTGTCACTGTGGTTGGG + Intergenic
937582062 2:123499151-123499173 CTTGGCCCATTACTAGGCTTTGG - Intergenic
937785203 2:125887712-125887734 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
937852567 2:126648722-126648744 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
937911606 2:127078250-127078272 CTTGCTCTGTGCCTGGCCTTGGG + Intronic
939069065 2:137517872-137517894 CTTGGCCTGTTACTGGGCTTTGG + Intronic
939213875 2:139212256-139212278 CTTGGCCTGTTATTGGGCTTTGG + Intergenic
939788682 2:146546097-146546119 CTTGGCCTGTTACTGGGGTTTGG - Intergenic
939806243 2:146778490-146778512 CTCGGCCTATTACTGGGCTTTGG + Intergenic
940053117 2:149484979-149485001 CTTGTTCTGTTTCTTGTCTTGGG + Intergenic
940171311 2:150832696-150832718 CTTGGCCTGTTACTAGGCTTTGG - Intergenic
940472087 2:154113111-154113133 CTAGACCTGTTACTGGGCTTTGG - Intronic
940605913 2:155924272-155924294 CATGGCCTGTTACTGGGCTTTGG - Intergenic
941330665 2:164174549-164174571 CTTTGCCTGTTACTGGGCTTTGG - Intergenic
941668019 2:168261144-168261166 CTCTGCCTGTTACTGGGCTTTGG + Intergenic
943006899 2:182395857-182395879 CTTGGCCTGTTATTAGGCTTTGG + Intronic
943239216 2:185362556-185362578 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
943317926 2:186412303-186412325 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
943384061 2:187181074-187181096 CTTTACCTGTTACTGGGCTTTGG - Intergenic
943385881 2:187203234-187203256 CTTGGCCTGCTACTGGGCTTTGG - Intergenic
943517595 2:188907226-188907248 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
944850088 2:203710091-203710113 GTTGCTCTGAGACTGGGCTTGGG + Intronic
945028604 2:205642816-205642838 CTTGGTCTTTTCCTGTGTTTAGG - Intergenic
945389320 2:209244996-209245018 TGTGGTCTGGTCCTGGGCTTGGG - Intergenic
945544871 2:211138173-211138195 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
945642181 2:212443853-212443875 CTTGGACTATTACTGGGCTTTGG + Intronic
945725842 2:213471479-213471501 GTTGGTCTGTTACTGGGCTTTGG - Intronic
946527865 2:220539951-220539973 CTTGGCCCGTTACTGGGCTTTGG - Intergenic
946703772 2:222437776-222437798 CTTGGCCTGTTACTAGGCTTTGG - Intronic
946790924 2:223299776-223299798 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
947440711 2:230118650-230118672 CCAGGCCTATTACTGGGCTTTGG - Intergenic
947440849 2:230120273-230120295 CTGGGCCTATTACTGGTCTTTGG + Intergenic
1169640383 20:7744344-7744366 ATTGGTCTGTTACTGTGCAGTGG - Intergenic
1172251111 20:33479883-33479905 ATAGGTCTGTTACTAGGCTGGGG - Intergenic
1174050400 20:47763625-47763647 CTAGGTCTGTTGCGGGGCTCTGG - Intronic
1176791678 21:13326120-13326142 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1176998163 21:15580200-15580222 CTTGGCCTGTTACTGGGCTTCGG + Intergenic
1177139413 21:17342253-17342275 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1177505558 21:22014166-22014188 TTTGGCCTGCTACTGGGCTTTGG - Intergenic
1177913178 21:27056226-27056248 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1177933695 21:27316916-27316938 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1177991069 21:28037122-28037144 TGTGGCCTGTTACTGGGCTTTGG - Intergenic
1178012662 21:28305191-28305213 CTTGGCCTGCTACTGGACTTTGG + Intergenic
1178060752 21:28851122-28851144 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1179415147 21:41192505-41192527 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1179709959 21:43207639-43207661 CTGGGTCTGTGGCTGGGATTTGG + Intergenic
1179830967 21:43995678-43995700 CTTGGTCTGGTCCCCGGCTTGGG - Intergenic
1179830976 21:43995714-43995736 CTTGGTCTGGTCCCTGGCTTGGG - Intergenic
1180197180 21:46204262-46204284 CTTGCTCTGTTGCTGAGGTTGGG - Intronic
1181367434 22:22388928-22388950 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1181420656 22:22795847-22795869 GTTGGCCTGTTACTGGGCTTTGG + Intronic
1183832322 22:40424908-40424930 CTTAGTCTGTTCCTGGCCTCTGG - Intronic
1184091022 22:42293081-42293103 CTTGGCCTCCTCCTGGGCTTGGG - Intronic
1184603558 22:45558359-45558381 CTTGGCCTGTTACTGGGCTTTGG - Intronic
949125662 3:443130-443152 CTTTGCCTGTTACTGGGCTTTGG - Intergenic
949170037 3:986588-986610 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
949245871 3:1924938-1924960 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
949290091 3:2455020-2455042 CTTCATCTGTTAGTGGCCTTAGG + Intronic
949417590 3:3830867-3830889 CTTGGCCTGTTACTAGGCTTTGG - Intronic
949606191 3:5656954-5656976 ATTGGTTTGTTACTGTGCTGAGG - Intergenic
949638782 3:6012532-6012554 CTCAGCCTGTTACTGGGCTTTGG + Intergenic
951122574 3:18945582-18945604 CTAGGCCTGTTACTGGGCTTTGG + Intergenic
951291516 3:20876730-20876752 CTTGGCCTATTATTGGGCTTTGG - Intergenic
951384528 3:22027550-22027572 CTTGGCCTGTTACTGGGCTTTGG + Intronic
951970760 3:28441850-28441872 CTTGGTCTGTTACTGGGCTTTGG - Intronic
952121260 3:30247205-30247227 CTTGGTATGTTGCTGGTCTAAGG + Intergenic
952605440 3:35142000-35142022 CTTGGCTTGTTACTGGGTTTTGG - Intergenic
952783411 3:37127047-37127069 CTTGGTATATGACTAGGCTTGGG - Intronic
952926224 3:38321549-38321571 TTAGGTTTGTTTCTGGGCTTGGG - Intergenic
953286444 3:41614919-41614941 CTTGTGCTGTTACTGAGCTAGGG + Intronic
953688460 3:45096591-45096613 CTTGCTCTGTCACTAGGCTAGGG - Intronic
954342726 3:49968505-49968527 CTTGGTCTTGAACTGGACTTTGG - Exonic
954511488 3:51129646-51129668 CTTGGCCTGTTACTGGGCTTTGG - Intronic
956360455 3:68441453-68441475 CTTGGCCTGTTACTGGGCTTTGG + Intronic
956703892 3:71982872-71982894 CTTGGCCTATTACTGGGCTTTGG - Intergenic
957247581 3:77733882-77733904 TTTGGCCTGTTACAGAGCTTTGG - Intergenic
957402986 3:79741118-79741140 CTTGCTCTGTTACCGTTCTTTGG + Intronic
957754600 3:84469441-84469463 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
958477413 3:94602465-94602487 GTTGGCATGTTACTAGGCTTTGG - Intergenic
958487675 3:94732459-94732481 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
958934305 3:100240643-100240665 CTGGACCTGTTACTGGGCTTTGG + Intergenic
959203648 3:103279230-103279252 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
959226776 3:103597261-103597283 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
959439511 3:106359197-106359219 CTTGGCCTTTTACTGGCCTTTGG + Intergenic
959746010 3:109777258-109777280 TTTGGACTGTTACTGGGGTTTGG - Intergenic
959997862 3:112698335-112698357 CTTGGCCTGCTACTGGGCTTTGG + Intergenic
960134878 3:114095028-114095050 CTTGCTCTGTTACTGAGGCTGGG - Intergenic
960349532 3:116575716-116575738 CTTGGTCTGTTACTGGGCTTTGG + Intronic
960494745 3:118360765-118360787 CTTGGCCTGTTACTTGACTTTGG - Intergenic
960972034 3:123146740-123146762 CCTGGTCTGTTACTTGGTTATGG - Intronic
960982870 3:123248135-123248157 CTTGCCCTGTTCCTGGTCTTAGG - Intronic
961262848 3:125616438-125616460 CTTGGCCTGTTACTGTGCCTTGG + Intergenic
961438668 3:126937492-126937514 CTTGGCCTGTCCATGGGCTTTGG + Intronic
961526720 3:127506527-127506549 CTTGTTTTGTTTCTGGTCTTAGG - Intergenic
963331814 3:143923358-143923380 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
963355660 3:144206845-144206867 CTTGGCCCATTTCTGGGCTTTGG - Intergenic
963453673 3:145516682-145516704 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
963630312 3:147723235-147723257 TCTGGTCTGTTACTGGGCTTTGG + Intergenic
963661396 3:148132160-148132182 CTTGACCTGTTACTGGGCTTTGG + Intergenic
964505863 3:157398308-157398330 TTTGGCCTGCTACTGGGCCTTGG - Intronic
964679242 3:159318899-159318921 CATGGCCTGTTACTGGGCTTTGG - Intronic
965226764 3:166000749-166000771 CTTGGCCTGTTAGTGGGCTTTGG - Intergenic
965520147 3:169662823-169662845 CTCGGTTTGTTTCTGGGGTTTGG - Intronic
966044327 3:175530906-175530928 CTTGGCCTGTTACTGGGCTTTGG - Intronic
966445696 3:179998574-179998596 CTTGGTCTGTTACTGGGCTTTGG + Intronic
967831779 3:193926005-193926027 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
968499147 4:938115-938137 CTTGGCTTGTTCCTGGTCTTAGG - Intronic
968800186 4:2738136-2738158 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
968831023 4:2933087-2933109 CCTGGTATGTTCCTGGGCCTGGG - Exonic
968906949 4:3457982-3458004 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
971101011 4:23466407-23466429 CTTGACCTGTTACTGCGCTTTGG - Intergenic
971857651 4:32062818-32062840 CTTGACCTGTTACTGGGCCTTGG - Intergenic
971979292 4:33732858-33732880 CTTGGCCTGCTATTGGGCTTTGG - Intergenic
972095496 4:35342704-35342726 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
972805919 4:42529342-42529364 CTTGGCTTGTTACTGGGCTTTGG + Intronic
972882958 4:43448139-43448161 GTTTGCCTGTGACTGGGCTTTGG - Intergenic
973102927 4:46294767-46294789 CTTGGCCCATTACTGGGCTTTGG + Intronic
973118445 4:46489058-46489080 CTTGGCCTGTTACTGGGCTCTGG + Intergenic
973120978 4:46520883-46520905 CTTGGCCTGTTACTGGGCTGTGG - Intergenic
974262368 4:59542254-59542276 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
974289572 4:59912757-59912779 CTTGGCTTGTCACTGGGCTTTGG + Intergenic
974644613 4:64674749-64674771 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
974727215 4:65812538-65812560 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
974746912 4:66088890-66088912 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
974917168 4:68193430-68193452 TTTGTTCTTTTTCTGGGCTTAGG - Intergenic
975386714 4:73767494-73767516 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
976034203 4:80795807-80795829 CTTGGTCTGTTAGTGGGCTTTGG - Intronic
977031625 4:91891422-91891444 CTTTTTCTGTTACTGGGCTTTGG + Intergenic
977326866 4:95584913-95584935 CTTGCTCTGTCACTAGGCTAGGG + Intergenic
977430769 4:96928227-96928249 TTTGGCCTCTTACTGGGCTTTGG + Intergenic
977466004 4:97383389-97383411 CTTGGTCTGTTACTGGGCTTTGG + Intronic
977490068 4:97700056-97700078 CTTGGCCTGTTACTGGGCTTTGG - Intronic
977626273 4:99192639-99192661 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
977701728 4:100029872-100029894 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
977833272 4:101618153-101618175 CTTGGCCTGTTACTGGGCTTTGG - Intronic
977930409 4:102743804-102743826 CTTGGCCTGTTACTGGGCTTTGG - Intronic
978341587 4:107725534-107725556 TGTGGCCTGTTACTGGGCTTTGG - Intergenic
978772149 4:112467765-112467787 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
978899072 4:113926803-113926825 CTTGGCCTGTTACTGGGCTTTGG - Intronic
978966855 4:114750957-114750979 CTTGGGCTTTTACTGGGCTTTGG + Intergenic
979767023 4:124474610-124474632 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
979888565 4:126062158-126062180 CTTGGCCTGCTATTGGGCCTTGG - Intergenic
979898399 4:126189042-126189064 CTTGGCCTTTTACTGGGCTTTGG - Intergenic
980306039 4:131063050-131063072 CTTGTTCTGTGACTGCGATTTGG + Intergenic
980385786 4:132087016-132087038 CTCTGTTTGTTATTGGGCTTTGG - Intergenic
980387945 4:132111166-132111188 CTTGGCCTGTTACTGGACTTTGG - Intergenic
980405888 4:132353776-132353798 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
980497524 4:133605347-133605369 CTTGGCCTGTTATTGGGCTTTGG - Intergenic
980693763 4:136329334-136329356 CTTGGTCTGATCCTGAGCCTTGG - Intergenic
980957734 4:139445932-139445954 TTTGGCCTGTTACTGGGCTTTGG + Intergenic
981835006 4:149043960-149043982 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
981873540 4:149515211-149515233 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
982623338 4:157732886-157732908 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
982835542 4:160116656-160116678 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
983027393 4:162755310-162755332 CTTGGCCTGTTACTGGGATTTGG + Intergenic
983185066 4:164691590-164691612 CTTGGCCTCGTACTAGGCTTTGG + Intergenic
983582678 4:169324827-169324849 CTTGGCTTGTTACTGGGTTTTGG + Intergenic
984060281 4:174982009-174982031 CTTGGCCTGCTACTGGGCTTTGG - Intergenic
984067211 4:175062819-175062841 CTTGGTCTGCTCCTTGGCCTTGG - Intergenic
985866188 5:2516305-2516327 CTGGGTGCGTCACTGGGCTTTGG - Intergenic
986025576 5:3847429-3847451 CTTGGCCTGTTGCTGGATTTTGG + Intergenic
986037030 5:3950422-3950444 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
986742922 5:10719521-10719543 CTTGGCCTGTTACTGGGCTTTGG + Intronic
986938329 5:12918735-12918757 CTTGGCCTATTACTGGGCTTTGG - Intergenic
987153179 5:15061681-15061703 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
987468186 5:18296969-18296991 CTTGGCCTATTACTGGGCCTTGG - Intergenic
987578339 5:19758296-19758318 CTTGGCCTGTTACTGGACTTTGG - Intronic
987657135 5:20821636-20821658 CTTGGCCTATTACTGGGCTTTGG - Intergenic
987885447 5:23806515-23806537 GTTGGCCTATTACTGGGCTTCGG + Intergenic
988056566 5:26105252-26105274 CTTGGCCTGTTACTCGGCTTTGG - Intergenic
988079828 5:26401404-26401426 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
988107761 5:26772562-26772584 CTTGGCTTTTTGCTGGGCTTTGG + Intergenic
988160822 5:27516855-27516877 CTAGGCCTGTTACTGGGCTTTGG - Intergenic
988169199 5:27632822-27632844 TTTGGCCAGTTACTGGGCTTTGG - Intergenic
988228771 5:28448142-28448164 CATGGCCTGTTACTGGGCTTTGG + Intergenic
988233285 5:28507074-28507096 CATGACTTGTTACTGGGCTTTGG - Intergenic
988238449 5:28576098-28576120 CCTGGTCTGCTTGTGGGCTTTGG - Intergenic
988562133 5:32290863-32290885 CTTGGCCCGTTACTGGGCTTTGG + Intronic
988766416 5:34382312-34382334 CTTGGCCTATTACTGGGCTTTGG + Intergenic
989045203 5:37267575-37267597 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
989307500 5:39974607-39974629 CTTGGCCTATAACTGGGCTTTGG - Intergenic
989457640 5:41661752-41661774 CTTGGCCTGTTACTAGGCTTTGG - Intergenic
989486381 5:41996343-41996365 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
991033547 5:62105938-62105960 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
991330734 5:65489668-65489690 CTTGGCTGGTTACTGGGCTTTGG - Intergenic
991946149 5:71900157-71900179 GTTGGCCTGTTACTGGGCTTGGG + Intergenic
992242958 5:74789883-74789905 CTTGGCCTGTTACTGGGCTTTGG + Intronic
992835111 5:80632630-80632652 TTTTATATGTTACTGGGCTTAGG - Intronic
993203394 5:84847556-84847578 CTTGACCTGTTACTAAGCTTTGG + Intergenic
993231898 5:85247517-85247539 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
993319829 5:86458594-86458616 CTTGGCTTGTTACCGGGCTTTGG + Intergenic
993367465 5:87050940-87050962 ATTGGTCTGTTACTGGGCTTTGG - Intergenic
993412579 5:87591796-87591818 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
993780696 5:92062410-92062432 CTTGACTTGTTACTGGGCTTTGG + Intergenic
994291369 5:98031955-98031977 CTTGGCCTGTTACTGGGGTTTGG - Intergenic
994984417 5:106915713-106915735 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
995189507 5:109305710-109305732 CGTGGGCTGGTACTAGGCTTTGG - Intergenic
995269554 5:110205450-110205472 CTTGGCCCAATACTGGGCTTTGG - Intergenic
995776284 5:115727663-115727685 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
996018563 5:118567872-118567894 CTTGGTCTGTTACTGGGCTTTGG + Intergenic
996164953 5:120212492-120212514 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
996825565 5:127677851-127677873 CTTGGCCTGTTATTGGACTTCGG + Intergenic
998290333 5:140908535-140908557 CTTGGCCTATTACTGGGCTTTGG - Intronic
999187589 5:149724026-149724048 CTTTGTCTCTTACTGGCTTTGGG - Intergenic
999351388 5:150874861-150874883 CTTGGCCTGTCACTGGGTTTTGG + Intronic
1000223242 5:159234232-159234254 CTTGGCTTGTTACTGGGCTTTGG - Intergenic
1000416975 5:160993918-160993940 CTTGGCCTGTTATTGGGCTTTGG + Intergenic
1001009423 5:168084745-168084767 CTTGGTCTGTAAGTGGCTTTGGG - Intronic
1001173598 5:169444659-169444681 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1003128439 6:3374701-3374723 CTTGCTCTGCTTCAGGGCTTCGG - Intronic
1003195761 6:3912910-3912932 CTTGGTCTGAAGCTGGACTTAGG + Intergenic
1003455828 6:6281376-6281398 CCTGGTCTGACACTGGGCCTGGG - Intronic
1003695895 6:8406123-8406145 CTTGGCCTGTTACAGGGCTTTGG - Intergenic
1003791223 6:9550008-9550030 CTTGGCCTATTACTGGGATTTGG + Intergenic
1004824286 6:19403219-19403241 CTTGGACTGTTACTGGGCTTTGG - Intergenic
1004860529 6:19800491-19800513 CTTGTTTTGTTCCTGAGCTTAGG - Intergenic
1004884974 6:20042551-20042573 CTTGGTTTGGTCCTGGGCCTTGG + Intergenic
1005185172 6:23157089-23157111 GTTGGGCTGTTATTGGGCTTTGG + Intergenic
1006001559 6:30969092-30969114 CTTGGCCTATTACTGGGCTTTGG + Intergenic
1006062354 6:31433239-31433261 CTTAGCCTGTTACTGGGCTTTGG + Intergenic
1006626198 6:35399675-35399697 CTTGCTCTGTCACTAGGCTGGGG - Intronic
1006745252 6:36337093-36337115 TTTGGTTTCTTACTGGGGTTTGG - Intergenic
1007097924 6:39225726-39225748 GTTGCTCTGTAACTGAGCTTAGG - Intronic
1007100736 6:39244658-39244680 TTTGGTCTGATACAGGGCTTGGG + Intergenic
1008266920 6:49439272-49439294 CTTGGCCTGTTACTGGACTTTGG - Intronic
1008400293 6:51055488-51055510 CTTGGCCTTTTACTGAGTTTTGG + Intergenic
1008691243 6:53981621-53981643 CTTGGACTGGTACTGGTCTGTGG + Intronic
1008698662 6:54072418-54072440 ATGGGTCTGTTACTGGGCAGTGG + Intronic
1009390109 6:63135061-63135083 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
1009660692 6:66606905-66606927 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1009770331 6:68136835-68136857 CTTGGCCTGCTACTGGGCCTTGG - Intergenic
1009851924 6:69208941-69208963 CTTGGCCTGTTACTGCGCTTTGG - Intronic
1010325327 6:74556582-74556604 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1010580751 6:77593888-77593910 CTTGGCCTGTTACTGGACTTTGG - Intergenic
1010818634 6:80388417-80388439 CCTGGCCTGTTACTGAGCTTTGG + Intergenic
1010938243 6:81886400-81886422 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1011039341 6:83013257-83013279 CTTAGCCTGTTACTGGGCTTTGG - Intronic
1011069105 6:83361682-83361704 CCTGGCCTGTTACTGGGCTTTGG + Intronic
1011357480 6:86487572-86487594 CTTGGTGTGCTACTGGGCCATGG + Intergenic
1012108566 6:95197720-95197742 CCTGTCATGTTACTGGGCTTTGG - Intergenic
1012344591 6:98170336-98170358 GTTGGCCTATTACTGGGCTTTGG + Intergenic
1012730464 6:102874336-102874358 CTTGGCCTGTTACTGGGTTTTGG + Intergenic
1012820807 6:104082935-104082957 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1012873276 6:104696468-104696490 CTTGGGCTGAGCCTGGGCTTTGG - Intergenic
1012920792 6:105219528-105219550 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1013406674 6:109849819-109849841 CTTGGCCAGTTACTGGGCTTTGG + Intergenic
1013537555 6:111077256-111077278 CTAGGTCTGTTGTTGTGCTTAGG - Intergenic
1014363394 6:120508337-120508359 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1014416989 6:121195406-121195428 CTTGGCATGTTACTGGGCTTTGG + Intronic
1014534194 6:122596605-122596627 CTTGGCCTATTACTGGGCTTTGG - Intronic
1014631643 6:123796818-123796840 CTTGACCTGTTACTGGGCTTTGG + Intergenic
1014833676 6:126132434-126132456 CTTTGCCTGTTACTTGACTTTGG + Intergenic
1015095447 6:129409584-129409606 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1015301964 6:131663203-131663225 CTTGCTTTGTTACTGATCTTAGG + Intronic
1015370973 6:132452312-132452334 CTTGGCTTGTTTCTGGTCTTAGG - Exonic
1015443282 6:133272548-133272570 CTTGGCCCATTACTGGGCTTTGG - Intronic
1015475752 6:133657508-133657530 CTTGGCTTGTTACTGGGCTTTGG + Intergenic
1016144292 6:140649419-140649441 CTTGGCCTGTTACTGGACTTTGG + Intergenic
1016174912 6:141069078-141069100 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1016372797 6:143392268-143392290 CTTGCTCTGTTACCAGGCTGGGG + Intergenic
1016419612 6:143870665-143870687 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1016576255 6:145572570-145572592 CTTGGTCTGTTACTGGGCTTTGG - Intronic
1016898708 6:149079553-149079575 CTAGGTCTGTAGATGGGCTTTGG - Intergenic
1017227804 6:152041075-152041097 CTTGGCCTGTTACTGTGCTTTGG - Intronic
1017244552 6:152208341-152208363 CATGATCTCTTACTGGGTTTTGG + Intronic
1017388454 6:153912190-153912212 CTTGGCCTGTTACCAGGCTTTGG - Intergenic
1017977113 6:159368040-159368062 CTTGGTTTGTTACTGGGCTTTGG - Intergenic
1018122925 6:160655206-160655228 ATTGGTCTGTTATTGGGCTTTGG - Intronic
1018535027 6:164810477-164810499 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1018570263 6:165202708-165202730 GATTGTCTGTTACTGGGGTTTGG - Intergenic
1018599890 6:165527543-165527565 ATTGGCCTGGTACTGGGCTTTGG + Intronic
1018803789 6:167242974-167242996 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1019870104 7:3752472-3752494 CTTGACTTGTTACTGAGCTTTGG + Intronic
1020396720 7:7725531-7725553 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1020710352 7:11597642-11597664 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1021988812 7:26122939-26122961 CTTGGCCTGTTACTGGGCCTTGG + Intergenic
1022064073 7:26832786-26832808 CTTGGTATCCTCCTGGGCTTAGG - Intronic
1022078888 7:27000345-27000367 ATTGGCCTGTTACTGGGCTTTGG + Intergenic
1024025133 7:45403590-45403612 ATTGGTTTGTTACTGGGCAGTGG + Intergenic
1024040540 7:45550161-45550183 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1024701667 7:51910279-51910301 ATTGGTCTGTTACTGGGCAGTGG + Intergenic
1024744209 7:52388460-52388482 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1024866106 7:53906360-53906382 CTTGGCTTGTTACTGGGCTTTGG + Intergenic
1024884340 7:54124638-54124660 CTTTGCCTATTACTGGGCTTTGG - Intergenic
1025718331 7:63984185-63984207 CTTGCTGTGTTACTGGGGTTGGG + Intergenic
1027685800 7:81277971-81277993 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1028043862 7:86091482-86091504 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1028141738 7:87282000-87282022 CTTGGCCTGTTATTGGGATTTGG + Intergenic
1028237823 7:88382837-88382859 CTTGGCCTATTACTGGGCTTTGG + Intergenic
1028935016 7:96455079-96455101 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1029099386 7:98115755-98115777 CTTGCTCTGTCACTAGGCCTGGG - Intronic
1029222314 7:99000375-99000397 CTTGGCCTGTTACCCGGCTTTGG - Intronic
1030245484 7:107380683-107380705 ATTTGTCTGGTCCTGGGCTTTGG - Intronic
1030277460 7:107736130-107736152 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1030368756 7:108674043-108674065 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1030931285 7:115525667-115525689 CTTGGCCCATTACAGGGCTTTGG - Intergenic
1031169658 7:118276797-118276819 CCTGGTCTTTTACTGGTCTGTGG + Intergenic
1031236829 7:119188031-119188053 CTTGGCCTGTTACAGGGCTTTGG + Intergenic
1031676560 7:124618380-124618402 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1031832998 7:126650032-126650054 CTTGTCCCGTTACTGGGCTTTGG + Intronic
1032153103 7:129446942-129446964 CTTGGCCTGTTACTGGTCTTTGG - Intronic
1032923468 7:136576100-136576122 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1033076260 7:138253061-138253083 CTTGGCCTCTTACTGGGCTTTGG + Intergenic
1035133505 7:156677292-156677314 CTTTATCTGTTACTCGGCTAGGG - Intronic
1035378115 7:158420410-158420432 CTTTGTCTTTTCCTGGGCTTGGG + Intronic
1037580682 8:20244482-20244504 CATGGTCATTTACTGTGCTTAGG + Intergenic
1038525857 8:28272748-28272770 GTTGGTCTGTTACTGTGCAATGG - Intergenic
1038716995 8:30000142-30000164 CTTGGTCTGTCTGTGGGCTGAGG - Intergenic
1039324166 8:36466510-36466532 CTTGGCCTGTTGATGGGCTTTGG - Intergenic
1041934555 8:63321345-63321367 CTCGGCCTGTTACTGGACTTTGG + Intergenic
1041986184 8:63924488-63924510 CTTGGCCTGTCACTGGGCTTTGG + Intergenic
1043259969 8:78184178-78184200 CTTGACCTGGTACTGGGCTTTGG - Intergenic
1044150801 8:88773090-88773112 CTTTGCCTGTTAGTGGACTTTGG + Intergenic
1044202392 8:89452503-89452525 CTTGGCCCATTACTGGGCTTTGG + Intergenic
1044285971 8:90412431-90412453 CTTGTTCTGCTACTGGGTTTTGG - Intergenic
1044633153 8:94298391-94298413 CTTGGCTTGTTACTGGACTTTGG - Intergenic
1045221841 8:100207080-100207102 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1046064854 8:109184014-109184036 CCTGGCTTGTTACTGGGCTCTGG - Intergenic
1046128671 8:109941587-109941609 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1046197560 8:110884238-110884260 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1046417635 8:113937779-113937801 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1046585783 8:116147704-116147726 CTTGGCCTGTTACTGGGTTTTGG - Intergenic
1046760405 8:118014524-118014546 GTTGTTCTGTAACTGGGCTCAGG - Intronic
1047654211 8:126958854-126958876 CTTGATCTGTTTCTGGGTTTTGG - Intergenic
1048053940 8:130846327-130846349 AGTGGTCTGTTTCTGGGCCTTGG - Intronic
1048614692 8:136059986-136060008 CCTGGTCTGCTCCTGGGCATTGG - Intergenic
1049100779 8:140577664-140577686 CTGGGCCTGTTTCTGGGCTCTGG - Intronic
1049141970 8:140963066-140963088 AGTGGTCTGTTACAGGGCTGAGG - Intronic
1049936691 9:506266-506288 CTTTTTCTGTTACTAGGTTTGGG + Intronic
1050482677 9:6102618-6102640 CTTGGCCTATTACTGGGCTTTGG + Intergenic
1051342050 9:16120874-16120896 CTCGCTCTGTTCCGGGGCTTGGG + Intergenic
1051791015 9:20802526-20802548 CTTGGACAGTTCTTGGGCTTTGG + Intronic
1051882149 9:21850677-21850699 CTTGGCCTGTTACTGGACTTTGG + Intronic
1052227592 9:26108391-26108413 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1052368654 9:27640851-27640873 CTTGGCCTGTTACTAGGCTTTGG + Intergenic
1052561523 9:30089741-30089763 CTTGCCCTGTTACTGGGCTTTGG - Intergenic
1052954522 9:34243138-34243160 CTTGGTCAGTTGTTGGGCTCTGG + Intronic
1053293862 9:36899602-36899624 CTTGGGTAGTTTCTGGGCTTTGG - Intronic
1055903937 9:81271189-81271211 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1056156669 9:83845224-83845246 CTTGGCCTGTTACTGGGCTTTGG + Intronic
1056314232 9:85372930-85372952 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1056353869 9:85778303-85778325 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1058019897 9:100076095-100076117 CTTGGCCTGTTAGTGAGCTTTGG + Intronic
1058259253 9:102809653-102809675 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1059196503 9:112375853-112375875 CTTAGCCTGTTACTGGGCTTTGG - Intergenic
1061628811 9:131858588-131858610 GCTGGTCTGTTACTGGGAGTTGG + Intergenic
1061976646 9:134071447-134071469 CTTGGACTGTTACTGGTCCGTGG - Intergenic
1186279498 X:7977133-7977155 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1186384091 X:9091747-9091769 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1186469764 X:9812094-9812116 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1187570546 X:20496352-20496374 CTTGGACTGGTACTGGTCTGTGG + Intergenic
1187604869 X:20871877-20871899 CTTGGCCTGTTACTGGGGTTTGG + Intergenic
1189154881 X:38746707-38746729 CTTGGCCTGTTACTGGGATTTGG - Intergenic
1190359763 X:49637781-49637803 CCTGATGTGTTACTGGGCTGTGG + Intergenic
1190996746 X:55617468-55617490 TTTGACCTGTTACTGGGCTTTGG - Intergenic
1191095704 X:56671160-56671182 CTTGGCCTATTACTGGGCTTTGG - Intergenic
1191630035 X:63312574-63312596 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1191658802 X:63629792-63629814 CTTGGCTTGTTACTGGGCTGTGG - Intergenic
1191719238 X:64215695-64215717 CCTCGCCTGTTACTGGGCTTTGG - Intergenic
1191932928 X:66394177-66394199 TTTGGCCTGTTACTGGGCTTTGG + Intergenic
1191941258 X:66483851-66483873 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1192633912 X:72800806-72800828 CTGGGTCTGTTACTGGAGTTTGG + Intronic
1192647798 X:72919995-72920017 CTGGGTCTGTTACTGGAGTTTGG - Intronic
1192661561 X:73047748-73047770 CTTGGCATGTTACCAGGCTTTGG - Intergenic
1192673252 X:73168403-73168425 CTTGGCCTGTTACTAAGCATTGG - Intergenic
1192898706 X:75471923-75471945 CTTGGCCTATTACTGGGCTTTGG + Intronic
1193297784 X:79852687-79852709 CTTGGCCTGTTACTGGGGTTTGG + Intergenic
1193447158 X:81618784-81618806 CTTGGCCTATTACTGGACTTTGG + Intergenic
1193573667 X:83174918-83174940 CTTGGCCTGTTACTGAGCTTTGG - Intergenic
1193832950 X:86310110-86310132 CTTGACCTGTTACTGGGCTTTGG + Intronic
1193904488 X:87225844-87225866 CTTTGACTATTACTGGGCTTTGG + Intergenic
1193914799 X:87351915-87351937 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1193957287 X:87878223-87878245 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1193990230 X:88298239-88298261 CTTGATGTGTTACTGCACTTTGG - Intergenic
1194179588 X:90695922-90695944 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1194343312 X:92731097-92731119 GTTGGCCTGTTACTGCGCTTTGG + Intergenic
1194443553 X:93961116-93961138 CTTGGCCTGTTACTGGGCTTGGG + Intergenic
1194513415 X:94822239-94822261 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1194521083 X:94919452-94919474 CTTGACCTGTTACTAGGCCTTGG + Intergenic
1194604387 X:95961955-95961977 TTTGGCCTGTTACTGGGCTTTGG - Intergenic
1194833961 X:98658817-98658839 CTTGGCCTGTTACTGGGATTTGG + Intergenic
1194849243 X:98852161-98852183 CTTGGTCTGTTACTGGGCTTTGG - Intergenic
1195782350 X:108479852-108479874 CTTGGCCTGTTACTGGGCTTTGG - Intronic
1195824917 X:108989662-108989684 GTTGCAGTGTTACTGGGCTTGGG - Intergenic
1196135966 X:112209830-112209852 CTTGGACTGTTACTGGGCTTTGG - Intergenic
1196943395 X:120799598-120799620 CTTGGTCCTTCACTGGGCTGGGG + Intergenic
1197002292 X:121452937-121452959 CATGGTCTGTTACTGGGCCTTGG + Intergenic
1197044417 X:121978338-121978360 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1197097471 X:122612851-122612873 TTTGGCCTGTTACTGGGCTTTGG + Intergenic
1197379998 X:125727892-125727914 CTTAGCCTGTTACTGGGCTTAGG - Intergenic
1197405088 X:126039211-126039233 CTTGGCCTGTTACTGAGCTTTGG + Intergenic
1197409323 X:126096402-126096424 CATTGCCTGTTACTGAGCTTTGG - Intergenic
1197477356 X:126941316-126941338 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1197591868 X:128419400-128419422 CTTAGCCTGTTACTGGGCTTTGG + Intergenic
1197646835 X:129027207-129027229 CATGGTCTGGCAATGGGCTTTGG + Intergenic
1198783037 X:140257784-140257806 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1199144439 X:144348952-144348974 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1199310424 X:146314387-146314409 CTTGGCCCGTTACTGGGCTTTGG - Intergenic
1199511932 X:148631933-148631955 CATGGTCTCTTACTGTTCTTGGG - Intronic
1200279907 X:154768358-154768380 CTTGGTTTGTTATTGGGAGTTGG + Exonic
1200340492 X:155390629-155390651 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1200521273 Y:4212043-4212065 CTTGGCCTGTTACTGGGCTTTGG + Intergenic
1200526250 Y:4278091-4278113 CTTGGCCTGTTACTGGGCTTTGG - Intergenic
1200651670 Y:5847762-5847784 CTTGGCCTGTTACTGCGCTTTGG + Intergenic
1200746055 Y:6904859-6904881 CTTGGCTTATTACTGGGCTTTGG - Intergenic
1200973121 Y:9177697-9177719 CTTGGCCCATTACTGGGCTTTGG - Intergenic
1201248472 Y:12031034-12031056 CTTGGACTGTTTCTGGCCTGCGG - Intergenic
1201529649 Y:14977881-14977903 TTTGGCCTATTACTGGGATTTGG - Intergenic
1202137957 Y:21686816-21686838 CTTGGCCCATTACTGGGCTTTGG + Intergenic
1202358011 Y:24072460-24072482 CTTGGCCCATTGCTGGGCTTTGG - Intergenic
1202512767 Y:25597653-25597675 CTTGGCCCATTGCTGGGCTTTGG + Intergenic