ID: 974746915

View in Genome Browser
Species Human (GRCh38)
Location 4:66088908-66088930
Sequence TCATTTTGAGAGACAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974746915_974746918 5 Left 974746915 4:66088908-66088930 CCAAGAGCTGTCTCTCAAAATGA No data
Right 974746918 4:66088936-66088958 GTTATCTTCAGAAGATGGCAGGG No data
974746915_974746919 25 Left 974746915 4:66088908-66088930 CCAAGAGCTGTCTCTCAAAATGA No data
Right 974746919 4:66088956-66088978 GGGCCTAGCTCCAAAATCCTAGG No data
974746915_974746916 0 Left 974746915 4:66088908-66088930 CCAAGAGCTGTCTCTCAAAATGA No data
Right 974746916 4:66088931-66088953 AAGTAGTTATCTTCAGAAGATGG No data
974746915_974746917 4 Left 974746915 4:66088908-66088930 CCAAGAGCTGTCTCTCAAAATGA No data
Right 974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG No data
974746915_974746921 27 Left 974746915 4:66088908-66088930 CCAAGAGCTGTCTCTCAAAATGA No data
Right 974746921 4:66088958-66088980 GCCTAGCTCCAAAATCCTAGGGG No data
974746915_974746920 26 Left 974746915 4:66088908-66088930 CCAAGAGCTGTCTCTCAAAATGA No data
Right 974746920 4:66088957-66088979 GGCCTAGCTCCAAAATCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974746915 Original CRISPR TCATTTTGAGAGACAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr