ID: 974746917

View in Genome Browser
Species Human (GRCh38)
Location 4:66088935-66088957
Sequence AGTTATCTTCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974746913_974746917 16 Left 974746913 4:66088896-66088918 CCCAGTAACAGACCAAGAGCTGT 0: 13
1: 193
2: 204
3: 150
4: 243
Right 974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG No data
974746911_974746917 25 Left 974746911 4:66088887-66088909 CCACCAAAGCCCAGTAACAGACC 0: 17
1: 155
2: 153
3: 106
4: 231
Right 974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG No data
974746914_974746917 15 Left 974746914 4:66088897-66088919 CCAGTAACAGACCAAGAGCTGTC 0: 13
1: 174
2: 196
3: 141
4: 196
Right 974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG No data
974746912_974746917 22 Left 974746912 4:66088890-66088912 CCAAAGCCCAGTAACAGACCAAG 0: 14
1: 178
2: 170
3: 117
4: 237
Right 974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG No data
974746915_974746917 4 Left 974746915 4:66088908-66088930 CCAAGAGCTGTCTCTCAAAATGA No data
Right 974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974746917 Original CRISPR AGTTATCTTCAGAAGATGGC AGG Intergenic
No off target data available for this crispr