ID: 974750522

View in Genome Browser
Species Human (GRCh38)
Location 4:66134648-66134670
Sequence TTCTGTGTGTTCTCACATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974750521_974750522 -1 Left 974750521 4:66134626-66134648 CCTATTCTTCATAGATGCTGCTT No data
Right 974750522 4:66134648-66134670 TTCTGTGTGTTCTCACATAGTGG No data
974750518_974750522 25 Left 974750518 4:66134600-66134622 CCAGCAGATTTGATATCTAGTGA No data
Right 974750522 4:66134648-66134670 TTCTGTGTGTTCTCACATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974750522 Original CRISPR TTCTGTGTGTTCTCACATAG TGG Intergenic
No off target data available for this crispr