ID: 974751452

View in Genome Browser
Species Human (GRCh38)
Location 4:66146448-66146470
Sequence GTCTGAAGTTCGCTGTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974751451_974751452 -8 Left 974751451 4:66146433-66146455 CCAATATTCTTTGGAGTCTGAAG No data
Right 974751452 4:66146448-66146470 GTCTGAAGTTCGCTGTTGAATGG No data
974751450_974751452 -7 Left 974751450 4:66146432-66146454 CCCAATATTCTTTGGAGTCTGAA No data
Right 974751452 4:66146448-66146470 GTCTGAAGTTCGCTGTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974751452 Original CRISPR GTCTGAAGTTCGCTGTTGAA TGG Intergenic
No off target data available for this crispr