ID: 974762058

View in Genome Browser
Species Human (GRCh38)
Location 4:66289880-66289902
Sequence GGGACTGTACCTACATTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974762058_974762062 2 Left 974762058 4:66289880-66289902 CCTAAAAATGTAGGTACAGTCCC No data
Right 974762062 4:66289905-66289927 ATTATTTTCCATTATAAGGTTGG No data
974762058_974762067 28 Left 974762058 4:66289880-66289902 CCTAAAAATGTAGGTACAGTCCC No data
Right 974762067 4:66289931-66289953 TGGGAACAAAGTGTGAAAATAGG No data
974762058_974762064 8 Left 974762058 4:66289880-66289902 CCTAAAAATGTAGGTACAGTCCC No data
Right 974762064 4:66289911-66289933 TTCCATTATAAGGTTGGGTCTGG No data
974762058_974762065 9 Left 974762058 4:66289880-66289902 CCTAAAAATGTAGGTACAGTCCC No data
Right 974762065 4:66289912-66289934 TCCATTATAAGGTTGGGTCTGGG No data
974762058_974762061 -2 Left 974762058 4:66289880-66289902 CCTAAAAATGTAGGTACAGTCCC No data
Right 974762061 4:66289901-66289923 CCAAATTATTTTCCATTATAAGG No data
974762058_974762063 3 Left 974762058 4:66289880-66289902 CCTAAAAATGTAGGTACAGTCCC No data
Right 974762063 4:66289906-66289928 TTATTTTCCATTATAAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974762058 Original CRISPR GGGACTGTACCTACATTTTT AGG (reversed) Intergenic