ID: 974765609

View in Genome Browser
Species Human (GRCh38)
Location 4:66341736-66341758
Sequence ATTTGCTGGTAGTAGTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974765609_974765613 -6 Left 974765609 4:66341736-66341758 CCATCCCACTACTACCAGCAAAT No data
Right 974765613 4:66341753-66341775 GCAAATTTTTTCTTTTTTTATGG No data
974765609_974765615 21 Left 974765609 4:66341736-66341758 CCATCCCACTACTACCAGCAAAT No data
Right 974765615 4:66341780-66341802 GGTGTCTTGCTATGTTGCGCAGG No data
974765609_974765614 0 Left 974765609 4:66341736-66341758 CCATCCCACTACTACCAGCAAAT No data
Right 974765614 4:66341759-66341781 TTTTTCTTTTTTTATGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974765609 Original CRISPR ATTTGCTGGTAGTAGTGGGA TGG (reversed) Intergenic
No off target data available for this crispr