ID: 974765609 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:66341736-66341758 |
| Sequence | ATTTGCTGGTAGTAGTGGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 974765609_974765613 | -6 | Left | 974765609 | 4:66341736-66341758 | CCATCCCACTACTACCAGCAAAT | No data | ||
| Right | 974765613 | 4:66341753-66341775 | GCAAATTTTTTCTTTTTTTATGG | No data | ||||
| 974765609_974765615 | 21 | Left | 974765609 | 4:66341736-66341758 | CCATCCCACTACTACCAGCAAAT | No data | ||
| Right | 974765615 | 4:66341780-66341802 | GGTGTCTTGCTATGTTGCGCAGG | No data | ||||
| 974765609_974765614 | 0 | Left | 974765609 | 4:66341736-66341758 | CCATCCCACTACTACCAGCAAAT | No data | ||
| Right | 974765614 | 4:66341759-66341781 | TTTTTCTTTTTTTATGGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 974765609 | Original CRISPR | ATTTGCTGGTAGTAGTGGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||