ID: 974779079

View in Genome Browser
Species Human (GRCh38)
Location 4:66528332-66528354
Sequence GTTCCACAAATCTCTAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974779079_974779080 -6 Left 974779079 4:66528332-66528354 CCTACACTAGAGATTTGTGGAAC No data
Right 974779080 4:66528349-66528371 TGGAACTTTGTAATTGAGAGAGG No data
974779079_974779081 3 Left 974779079 4:66528332-66528354 CCTACACTAGAGATTTGTGGAAC No data
Right 974779081 4:66528358-66528380 GTAATTGAGAGAGGTGATTTAGG No data
974779079_974779083 11 Left 974779079 4:66528332-66528354 CCTACACTAGAGATTTGTGGAAC No data
Right 974779083 4:66528366-66528388 GAGAGGTGATTTAGGGCATCTGG No data
974779079_974779082 4 Left 974779079 4:66528332-66528354 CCTACACTAGAGATTTGTGGAAC No data
Right 974779082 4:66528359-66528381 TAATTGAGAGAGGTGATTTAGGG No data
974779079_974779084 14 Left 974779079 4:66528332-66528354 CCTACACTAGAGATTTGTGGAAC No data
Right 974779084 4:66528369-66528391 AGGTGATTTAGGGCATCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974779079 Original CRISPR GTTCCACAAATCTCTAGTGT AGG (reversed) Intergenic