ID: 974779080

View in Genome Browser
Species Human (GRCh38)
Location 4:66528349-66528371
Sequence TGGAACTTTGTAATTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974779077_974779080 -4 Left 974779077 4:66528330-66528352 CCCCTACACTAGAGATTTGTGGA No data
Right 974779080 4:66528349-66528371 TGGAACTTTGTAATTGAGAGAGG No data
974779078_974779080 -5 Left 974779078 4:66528331-66528353 CCCTACACTAGAGATTTGTGGAA No data
Right 974779080 4:66528349-66528371 TGGAACTTTGTAATTGAGAGAGG No data
974779079_974779080 -6 Left 974779079 4:66528332-66528354 CCTACACTAGAGATTTGTGGAAC No data
Right 974779080 4:66528349-66528371 TGGAACTTTGTAATTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974779080 Original CRISPR TGGAACTTTGTAATTGAGAG AGG Intergenic