ID: 974779083

View in Genome Browser
Species Human (GRCh38)
Location 4:66528366-66528388
Sequence GAGAGGTGATTTAGGGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974779079_974779083 11 Left 974779079 4:66528332-66528354 CCTACACTAGAGATTTGTGGAAC No data
Right 974779083 4:66528366-66528388 GAGAGGTGATTTAGGGCATCTGG No data
974779078_974779083 12 Left 974779078 4:66528331-66528353 CCCTACACTAGAGATTTGTGGAA No data
Right 974779083 4:66528366-66528388 GAGAGGTGATTTAGGGCATCTGG No data
974779077_974779083 13 Left 974779077 4:66528330-66528352 CCCCTACACTAGAGATTTGTGGA No data
Right 974779083 4:66528366-66528388 GAGAGGTGATTTAGGGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974779083 Original CRISPR GAGAGGTGATTTAGGGCATC TGG Intergenic